Detailed Information [105178]
 

Strain Information
DGRC Number 105178
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP6273 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP6273 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 22A1; -; 22A2
Map Viewer
Related Genes lea snRNA:U3:22A
Original Number 6273
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP6273

NP line. Received from the National Institute of Genetics.

Original Comments comment1:A, comment2:22A1-A3
Balancer CyUW14
Cluster id 990
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression epidermis (TU)
Larval GFP DT fusion cell. other fusion point ?
Larval X-gal HZ84 like, dorsal gradient in the tibia,
Adult GFP strong thorax. leg muscle.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np44945_0912
Strand Plus
Insertion Point 1422337
Chromosome Band 2L
Flanking Sequence
ntatattaaaaanattntttngggngcactgncntttttgtgtacttcggtaaggcttcg
gctatcgacgggaccaccttatgttatttcatcatgCACGTGCCCTAGGTTTATCGTCGA
GTCGTGCAACATTTCGGGTGGTGGTGCATCATCATGTTGCTATTGAGTGGATGTGAATTG
TTGGAATATGTATCTGACTTCCAGGACTAGATGGGGATTTCTTTGCAGCACAACACATAG
TCATGTATTTATTGGCTTTTTTTTTATGAATAATCTGCATCATTTGCTAATACAAAAAAA
TCTACATTCAAACGGACTTTAACACCATGCCACATCCATTTCCAAGTCCAACTTGTTTAT
CTCCAGCTCTTTTCCATTTTTATTCGATCGAAGAATNCATAAGAGAGAACCGNCGCCAAA
GAACCCATTATTGTTGGGGNCCGTTTTCAGGAAGGGCAAGCCATCCGACATGTNATCCTC
TTCAGACCAATCAAATCCATGAAGAGCATCCCTGGGCATAAAATCCAACGGAATTGTGGA
GTTATCATGATGAGCTGCCGAGTCAATCGATACAGNCAACTGTCTTTGACCCTTTGTTAC
TACTCTCTTCCCGATGATGANGCCCCACTTATTCTATGCTGNCTCAATGTTAGAGGCATA
TNAGTCTCCACTGAAGCCAATNTTATNTTGGNTNNNNGNTTTCCTTTNGNAGAGNNANCG
GTCNCCNTNANNNNCNNTTTGCTTTGNNCGGGGNCCCNTNTNTCNAGGAAGGNGCCAGGC
CTNATCTCNNNTTNTCGCTNgtnncccgngactnttttcccntcccctcnaactggnttt
ccttgggnccnnnnctnccccncnnnttccctttgcnngcggncncttggntggcccgcn
gnngccngnnggnggtggnggcntaggccggntgnngcnccnccgngtcagantt

Image Files
Disc

d1 (->Large)
Larval GFP

g1 (->Large)

g2 (->Large)

CLOSE