Detailed Information [105234]
 

Strain Information
DGRC Number 105234
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP6509 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP6509 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 77E6
Map Viewer
Related Genes CG11396 CG11399 CG4289
Original Number 6509
Chromosome 3
Comments NP line. Received from the National Institute of Genetics.
Balancer TM6UW23-1
Cluster id 2010
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression weak
Larval GFP sg
Larval X-gal sg, DT, nidgut
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np46085_0912
Flanking Sequence
NGGGNANGGGNGANNCANNNANNAAGNNANNNAAAAAAATTTTTTNGAANGNNANAACCA
AAATTTAANGAANCTNNAGGGNAAGGCTNGGGGNTATANGAACGGGGACCACCTTGATGG
TATNNANGATANATGGGACTGNAGCGNGTANACGGNAAANNNTAAACNACTNTGANTGGN
TGNANNATGACNNTCTNNCTATTNCNCGTNNACNNNNCCGNGGCTNCNCTTTNGNCGNNN
CAGGNCTCNANNANCCNNCNNNTCNNGNCCGCNNTATNNATTNTGANGTNCNNCNTNTTN
TTNGANTGNNGNCCCTGANNNNNCANTGNNAGNTGNNAANNNNNNCNCANAGNATANNNT
TATCACGCAGNNNNNNNCTNCNCCCCNTNTNNAGANTNANAACANGAATNATNNTTANCG
CCNTCCGCCNNTTATANCACAGANGNTTNGCNNACGNACCNGNATNNNGTTNNATGNTTA
CNGNTTCCNTNNNGNTAANCGCTATNNNNCCCCNTATNNCGCCTATTNANAATNNNCCNA
TCANTCNNCCNCTNATTNCCCNCANNCATANNTTCCTCCGTNNTTNCNANNCACCNCNCN
NCCNCCCNCCTGTNTNCCNCAATTCCCCTTTTTATATNCGATNATCCNNNTTTNGCTCGN
CCNNTNTAGNANCNCCNTNNNTCCCTTGNNACNGTNNGCNCTANTNNTNNNCNGNTNCCC
ANNNTAANTGNNTGCCNNNAGCNTNCNCCCGNTCNANNNNGNTATTAACANATNTCAATC
NCNNCACCCNGCNTNCTNNAnnctatccgancaccnntannnacaatccccgtannctcn
aancannacaannngaagnnnnatccgcannncgctnncgtacatgcanantatngtnaa
nngccacataccgnnnanttatntnanattgnatccnnaccgantcgngnntcccnttna
nctatacactntgcgtantgttcaanntccnccntantatacatnttangncagcacncc
ntttttttncanannctatntangcncatnntgtntcnanttntnananatnngacangn
gtnnnnaagccnncnngnnnngaatattncngcggnganttnnntnnnnttngcantcng
cccngccntntaccnnnnccngcannctntngnnnttttcncnctatntcganccgttnt
ctnaccnnncngcgtncanagatcagancnanangacgcncacgcncttctatttccccn
caactananntataatanaccnccacncagncgcgcnnttcctcctatacnnccntntat
cnnnncagncncncnaggaacggantccgccccacannatntnttntntnacnnatattn
cncnttcaatctngcccccntttccttattcannncanntncnatancnncnnncntatg
naannaccnttgtgccgtncncncgtttnnt

Library Name / Clone Name np / np66333_0309
Strand Plus
Insertion Point 20703233
Chromosome Band 3L
Flanking Sequence
ctttttgcgcacttattgcaagtcttcgttaagtggatgtctcttgccgacgggaccacc
ttatgttatttcatcatgGGCCAGTCGACAACAGCCACTCAGCGGAGCGAGATCCNCGGC
CTGCNGCATNGGCCACTAGTGNNTCTGGATNNTCTNGNTAGTNNTNTNTTGACTNCTAAN
TAATTANANAANATANTTNNAACCCCTCGGCNCANGCTAATTNTTTTTNTGAAATAANAN
ACNCNCGGNGGNGATANNAGGGATTAAANANNAATATNATNGNNTTTTNNTNNNNNNNCN
TNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnn
tnnnnnnnnnnnnnnnnnnntnnnnnntnntnnnnnntnnnnnnnnnnnntnnnnnnnnn
nntntnnnnnnnnnc

CLOSE