Detailed Information [105246]
 

Strain Information
DGRC Number 105246
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}CG3967[NP6536] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}CG3967NP6536 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 67B4
Map Viewer
Related Genes aay CG3967
Original Number 6536
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP6536

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1840
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression muscle (uneven), pmg.
Larval GFP strong gut
Larval X-gal sg, fb, oenocyte, gut
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np46325_0912
Strand Minus
Insertion Point 9380694
Chromosome Band 3L
Flanking Sequence
gccntgaattaagtgtnacttcggtaagcttcggctatcgacgggaccaccttatgttat
ttcatcatgGACCACACGGAACGAAAAAATGATTACCGACCACACGGAAAGAAAAATTTA
TGTCCAGACGAAACTATTTTTGTCCAACTAGCTGATTTGCATAACAATTTAAGCCACAAG
AAACTAGATTAAAATTTTACATTTAAATACATTATCAAATCGAAATATCAATAATTGTAA
TTTATTCTTACAAAATGTAAACGCAGTTGCTTTCTTTTTAGTGTAGCGATCGAAGAATAC
ATACGAGAGAACCGTCNNCAAAGAACCCATTATTGTTGGGGNCCGTTTTCAGGAAGGGCA
NGCCATCCGACATGTCATCCTTCTNAGACCAATCAAATCCATGAAGAGCATGCCTGGGCA
TAAAATNCAACGGAATTGNGGGGGTATCATGATGAGCTGGCGAGTCAATTCGATACAGNC
AACTGGCTTTGACCTTTGTTACTACTCTCTTTCGATGATGATGNNGCACTTATTCTATGC
TGNCTNAATGNTAGAGGCATATCAGTCTNCACTGANATCNNNNTNTNNNNGGGNGGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE