Detailed Information [105270]

Strain Information
DGRC Number 105270
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP6582 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP6582 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site ---; ---
Map Viewer
Related Genes CG40153 CG40230 CG40233 CG40328 CG40365
Original Number 6582
Chromosome 3
Comments NP line. Received from the National Institute of Genetics.
Balancer TM6UW23-1
Cluster id 2070 2102
General Information NP_lines
Embryonic Expression a small # of cells
Larval GFP sg
Larval X-gal ch organ, sg, epi
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np01785_0711
Strand Plus
Insertion Point 3251504
Chromosome Band U
Flanking Sequence
gtttttgnnnngacnacgtngnaaaaancnccnnntgggggacnnaaaaacccttcggct
atcgacgggaccacnttatgttatttcatcatgGGTGTGCNTAAGTATTGGTGTATGCGG
ACTAGAACAACTGTCATAATTGTGTTGGTATTGCATGTAAAGTCAAGAACTACGCATAAT
TCTGATTTTGTGAAGAAGAgatcgaagaatacataagagagaacntttttnnaagaaccc
attattgttggggtccgntttcaggaagggcaagccatccgacatgtcatcctcttcaga
ccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtggagttatc
atgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttgttactactctc
ttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctc
cactgaagccaatctnattctngnnnnnnnnntnnttttgnggggnnnnnnnngnangnc
cccnnntnntttngnnnnnngnnnnnnnnnnnnnngncnccnnnnnnnnnnnncnnnnnn
nnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnngnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnngnnnnnnnnnnnnnnnn
ntnnnnnngnnnnnnnnnngngnnnnncnnnnnnnnnntnnnnnntnnnnnncngnnngn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnngtnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaaaanaaaaaaan

Library Name / Clone Name np / np54183_0309
Flanking Sequence
GNNNNGNGNGGNGGGNNNGNNAGGGGGNGGNNNGNNNNGTTTTGGNNNGGNTTTTGNGGC
NTTANCGCAGTCTACGTTAGTGGNTGTCTCTTGCCGACGGGNACCCCTTAGTTATTTCAT
CATGTGCACACCGCATTTTTCTGTATGCTTCTCGCTTTCGTACAGACATCTACTTCCCCC
CGCTCCTACCCGCGACCAGACTACGGTCGGCAGAAACTCTAACGGTTGTCTGCCGCGCAT
CAGAAAAATAAAAAGAGGCGTCTGCATGGCGCGTGCCAAGCAGAATCACGAAATTTCGTT
TCATTTAAATGATCCTCTAGCTAGAGCTTTGCGTACTCGCAAATTATTAAAAATAAAACT
TTAAAAATAATTTCGTCTAATTAATATTATGAGNNAATNAAACCCCACGGACATGCTNNN
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnn

Library Name / Clone Name np / np70875_0810
Strand Plus
Insertion Point 1310323
Chromosome Band U
Flanking Sequence
gtcaacgtgcactgnanttantgtatacttncggtagcttcggctatcgacgggnaccac
cttatgttatttcatcatgGGTGTGCATAAGTATTGGTGTATGCGGACTAGAACAACTGT
CATAATTGTGTTGGTATTGCATGTAAAGTCAAGAACTACGCATAATTCTGATTTTGTGAA
GAAGAgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggt
ccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccat
gaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccg
agtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatgatgatg
tcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgagntctttt
tttttgggnnnnnnncatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnng
nnnnnnnnnnnnnnnnnnnnnnnnnnnnncatnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnn


CLOSE