Detailed Information [105276]
 

Strain Information
DGRC Number 105276
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}btl[NP6593] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}btlNP6593 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 70D2
Map Viewer
Related Genes btl l(3)70Da CG8100
Original Number 6593
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP6593

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1899
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression midline, 1 amg, pmg, yalk; 2 PNS subset ? (ch?)
Larval GFP sg, tr
Larval X-gal ch organ, CNS, sg, weak epi
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np38815_0907
Strand Minus
Insertion Point 14025809
Chromosome Band 3L
Flanking Sequence
ANCNTTTGGGCACTAAACCAANTTTNTACTTCGGTAGCTTCGCTATCGACGGGACCCCTT
ATGTTATTTTNTCATGCTCCCCGCATGTTGCAATTTGTTTTCGCTGGAGTTTCCCTGAGC
GGTTCCCTTTNTTTTNATTGGCTGGTTGGCTGCTGCTGCTTTCTGGCTAGGTTCTTGGTG
GGTTTTATTCNAAGCATGTTGNCGGGGGCTCCACTCGTGNAAATNNTTNATNATCGGCCC
TTCGGGTTCCCTCCTTGTTGGTTGGCTNGGCGGNTTAATTAATGCAAAAAAAAATGNGTC
CATNGTCCTAAGNGGNGNGCAGNNCGTGCNCATGCNCGGTAATCGCATATNAATAAGGAA
ATATCCGTTNCGTGACTGATATCCAAAAATCTNAGTTGCTGCATGTGGCATGGCAGCAGC
TAGCTCCCGCATAGGCCAAAATCCTGATCTNNAAGCNGGNGNCNAACCNCCCCATAAANG
GGNNNGGNGCCCTGATTGCCGGCNCTCCCCTNGNGGGACTTTGGGNGGGTTACCCNCNAC
AAGCCCGGANGAATCCNAAAAAGGGGGAACCGAACAGCCCCANAANCCCCCTNANCNGNA
AACNTTGGCTTTTTTNNACNCNCGTGTNNCCTNTCCNCNAAATGAANATCCTTTTGCCTG
CCCCCCAAAATTNTGGAACGNGCCNTCCNNGACCTTAACCCGNAAANNAANGGGGNAANA
ATTTNNNAAAGGAAANAACCCTNTTAANNNGGNAAANTCCCCCTTTTTTTTNCCCCGNNC
NCCCNTTGGNCCNTTTTNGNaagaaaaaaaggnntttttnttttttttccnccccccccg
ggtnggagnctnggtttttttcccaannaatnanannnntnannnngggccccttttngn
ccccccggggggnaaanntnnntnnnncncccccnaaananncgnnnttttccnanaatt
ttaaccncccnggggtncccncnnttncnangncccgnncncntttnacannggnntccc
nncaaancnt

Image Files
Embryo

e1 (->Large)

e2 (->Large)

CLOSE