Detailed Information [105277]

Strain Information
DGRC Number 105277
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP6594 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP6594 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 77A3
Map Viewer
Related Genes CG13813 CG17149
Original Number 6594
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP6594

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1998
General Information NP_lines
Embryonic Expression PNS (ch organ) (TU), ring gland
Larval GFP sg, oenocyte.
Larval X-gal sg, oenocyte, mt,
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]

Library & Clone Information
Library Name / Clone Name np / np38825_0907
Strand Minus
Insertion Point 20149223
Chromosome Band 3L
Flanking Sequence
gnnngnnnnngnnnggngggnnngccccggggcnggggtngtnngttttnttgggnnggn
aaaacnaggggcactnaaacccagtttttggggncggnaagacttcggctatcgacggga
ccaccttatgttatttcatcatgCCGCGAACCGTAAATATCGGCCATTGAACTTGACAAT
CGTGGTACATGCACGCCCCCAAGAAAGCTCGTGCACGGTATAGCACGATCGGATCTAACN
NGNNACTNGNGGNCCACNNGNACGNATGGANGNATACGTGNACANGTATGCACCCNCACC
GNGCGGGCGCNGACNGGNTGCACNACCGAGCANTNCGCCCCAGAGACCCNCCAGCGCTGA
ACCNAATAAGGNNGCAGACAGGAGCGAGGAANGGCNAACGATCCGCCNTGGNANNCTNGN
CANAGANNGCGAACTGGGGAGGAGGNCGCTGGACNGACACAAACGACGGAAGAGGNGGGC
CACNGGGCGAGACCGCANANANAACCGGNNCANCNACCNGANCCCACCCAGNGGCGGGGN
NNANTGANGACGAACTGGCGAACNAAANGNAGGCGGANNAAGCGNNCANGGNATNNNAAA
CNCANTGAAGCCAGGNNNNGGGGACCCANNNNNNNACANNGGNNNNNANNANGANNCCAN
NAGANNNNAAAAAAANGGAAGGGNNNNAAGGNGGNAGNANNNNGAAANNNGNCCTNAANG
GAAAGNACCCANNAAAAAAANGGGGGNNANNNAANNNNCNNNNNNNAAANNNAANNANNA
AAANCCTNANGGAAAACCNNnnnaaggngnnnnannnncnnaaaaaggaanaccncccnn
aangggngggnnangggggnccgggaaggnnnnnnannnannaangncnnnnggnnggnn
nnnannannccnnnncnaaaanaaccnnnnnnccnnnggnnccnnnnnnnnggnnggggg
nnnnnnnnnnnnnnnnngggnnnannnnnnnnnngnnnnnnnnnnnnncnnnnnnnnnnn
ncnnnnnnnnnnnnnnnnnngngggnncccccccn

Image Files
Embryo

e1 (->Large)

e2 (->Large)

e3 (->Large)


CLOSE