Detailed Information [105294]

Strain Information
DGRC Number 105294
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP6621 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP6621 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 69A2
Map Viewer
Related Genes CG17144 CG5626
Original Number 6621
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP6621

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1880
General Information NP_lines
Embryonic Expression sg
Larval GFP sg
Larval X-gal sg,
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np01485_0711
Strand Plus
Insertion Point 12163567
Chromosome Band 3L
Flanking Sequence
gtgtttggnnnaacacnnangtngggnaanncacnccncntggggcnnanaaaacccccg
gctatcgacgggaccaccttatgnnatttcatcatgGGNCGGGNCGNGNNNNGANACCAT
CATTAACANGCTTACCAANTGNTACCGATGAATCGATTACTTTTGGCGGGCTTATATCGT
TTTTGAAANTCGGAGTAACTNTAACTTAAGAAAAAATNNCTGAAACCCTTTTTTTTNNGT
TTCAGTTTGCATCATTCTGAGGNAANTCAACACCTAGANGGCCTTTCCCAAAAAGCAATA
CACCANGGGGGNGCTATTTATAAATCTTNATTCTNNGTATAANTGTAGTTTTGNTAGTTT
CGCATAACATACGCTNAACATTTCTTGCCCTCTCATGCAATGGAGCTTGTCGAAATCTCG
AACTCGTTTTAATNGANGTCATATAACATTTTACACCTTGAAAATACACTTANNGGTAGA
TTTATGAACATTTAATACACCACATTGGGNGCTTTTAACTCTTATGCTGNTAACATTTTC
TCATCGACTCGACAATTTCAACTTCACGTATATTGCAGGATATTTCTAGGNGGCTTTCTT
TTCTTTGGTTCTTCGGGTTCTGGCTACACCGCAAAGGTTTTTTAAACTCTGGAACNGCGA
AACGAACCCCCTTTCTGGTNCTGCNGGGTGGGAAAAACCTAAATACAAAAATTATNCNCT
ATAACNAACCGGACATNGGAAATGGGNNANCATTANGGAAAAGGGNACCCAAAACCGGAT
NAAAAGGGAAGCGGCCGGGGgattggnaaaaaaggtncccccaaaggagggggggccccc
ctnaantgggcccctggggaaaggcccccnaaaagggnaanatgggncaccaaaattggg
aanaaaacaaaagg


CLOSE