Detailed Information [105307]
 

Strain Information
DGRC Number 105307
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP6644 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
y* w*; P{w+mW.hs=GawB}NP6644 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 71F1; -; 71F2
Map Viewer
Related Genes comm comm2
Original Number 6644
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP6644

NP line. Received from the National Institute of Genetics.

Original Comments comment1:B, comment2:7.90E+04
Balancer TM6UW23-1
Cluster id 1926
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression clean and strong pair rule in stg ~9, later expressed in all epidermis.
Larval GFP weak tr
Larval X-gal center of the leg disc, hinge of hte wing disc,
Adult GFP head, abd
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np01455_0711
Strand Plus
Insertion Point 15648847
Chromosome Band 3L
Flanking Sequence
antcttggggnaaaaacccccnttttgnatacttcggnaagcttcggctatcgacgggac
caccttatgttatttcatcatgGTCCGGAGTGTAAATCCAAATCTACCTGGCCAAgatcg
aagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgntttcag
gaagggcaagccatccgacatgtcatcctcttcagaccnttcaaatccatgaagagcatc
cctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcga
tacagtcaactgnctttgacctttgttactactctcttccgatgatgatgtcgcacttat
tctatgctgtctcaatgttagaggcatatcagtctccactgaagccatcttttttntggc
gaangatgatgtcgcacttattctatgctgnctcaatgnnagaggcatatnantctccac
tgaagccaatctnnnnttgnnnaannnnnngnnnnggncnnnnnnnggnaaaannannnn
annnngcnnnnncngnntnnntagnctngattncnnntnnngnnnnangnnnncctannn
nnnnnnnaccttnnngnnnnngngnngannnnnnacnctnncnnnnnnnnnnnnnncnct
nggnnncnntnnnnnnnnnnnnnnngnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnngnnnnnnnnnnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncncn
nnnnnnnnn

Image Files
Disc

d1 (->Large)

d2 (->Large)

d3 (->Large)

d4 (->Large)
Embryo

e1 (->Large)

e2 (->Large)

e3 (->Large)

CLOSE