Detailed Information [105326]
 

Strain Information
DGRC Number 105326
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}CR32028[NP7007] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}CR32028NP7007 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 66C13
Map Viewer
Related Genes CG6983 CG7015 BcDNA:LD13080
Original Number 7007
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP7007

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1826
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression foregut. not in trachea.
Larval GFP tr node, sg
Larval X-gal sg, CNS, stripes in epi
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np33035_0907
Strand Minus
Insertion Point 8401074
Chromosome Band 3L
Flanking Sequence
gnnnggngggnnngnnaggggnnngnnggnnnngtttttggnnnngtcttnttggggtga
natccatttttntgtatacttncggtaagcttcggctatcgacgggaccaccttatgtta
tttcatcatgGCGCCCGCTAGCAGTTGTTGTGCTGGCGTGTGGTACGTGTGGNTGGNCCA
NAAAATNCTCGTTCGCTNNAANTAGGANTATNATTTAACTNAAATNNGGAACGAAANCAT
GCAGAAAATGTGCCGNGAACAAAGCTGTGATGGAAAAATATGAAATGTGTTAGGGAAATT
AGTTTTTAAATGGCGAATTAACGTTTTTTCGTTGCCCAGCCAGATTCNCTACGCTTNTGT
GTGNGAGNGNGNGCGNTAGAGGGANCCANATNNGCANCCCGAAAAANAANCAGATGAAAA
TTCGATTTTCTTGCTANCACCTNGACACTTAGGAGACTGTGCATGTGTGTGAAGCAGTCT
GCGGNNTTGNTAATTNGACGCTAAAANCCACAACANTNCATGAGTAAAAATAGACGANGA
CGGCAACGCGCGTGNGCGTGCNTGTGNGTGTGCACACANACGAAGCACCAGNGTGTGCGC
ANTTTCNNTCGCGGNAGGCAAAGNTGTTTNNATGTNCAACACTGAANANTNGATAAAACT
GCNNCNAGACTNTCGGGGTNNATTACACTAGCCNAGAATGAGGGACGTTNTNAAGAAGGN
GNATNNTTTNNTCNTAATCGNCTCCACCTTTCTTTTTTTCTCATNAAACAGCTTNTGGGA
CTAAAACTCCGGNGGGACNNcnctttatcatgatnggnaaacgtnttaattntntaaaaa
acccncccctgtccgtcnaaaaaaaaanattnccccntngaancgactnaaaaattgccc
ctccaatttanaggcnatattgaagtcgcgnnnnnnnaancccccccccttnntnaangg
aaagncaagcaaacctttagtttggcccttttgtttgttcgtggttgaaaaaaacanaaa

CLOSE