Detailed Information [105345]
Strain Information
DGRC Number 105345
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}Ret[NP7045] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
y* w*; P{w+mW.hs=GawB}RetNP7045 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 39B1
Map Viewer
Related Genes Ret CG31624 Mcm10
Original Number 7045
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP7045

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1281
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality semi lethal
Embryonic Expression weak mesoderm
Larval GFP sg
Larval X-gal sg
Adult GFP internal abd.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]

Library & Clone Information
Library Name / Clone Name np / np33335_0907
Flanking Sequence
atttttggcgngcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggac
caccttatgttatttcatcatgACTTTAGGATTCTgatcgaagaatacataagagagaac
cgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatccgaca
tgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacg
gaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgac
ctttgttactactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgtta
gaggcatatcagtctccactgaagccatcttnttttttnngnnnnnnnnnnnnnnnnnnn
nnnnnngnnnnnnnntnnntnnnnnnntnnnnnnaangnntnnnnggcntnnnnnnnnnn
nnanngnnnnccnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np63063_0309
Strand Plus
Insertion Point 21156714
Chromosome Band 2L
Flanking Sequence
gnnnngngggngngnnngccagggggngggnggnnggtttttggattggattatngggga
aaaacccgcagtttgncgttagtggaagtctcttgccgacgggnaccccttatgttattt
catcatgCCTAAAGTCTAAAGTCCATATTAGAAAAGCTCGATACCGAGGCTTGAACGNCA
ATCAAATCAGAATAATTATCAGAGTTCAGTTTGAGACCTAATTGTAAAAGGTCGGNGTTC
TTCTCAAATAAAAAGATTGTAATCATTTAGTGAAATAAAAATNATATTTTNTNNACTNAT
AAATATTGCAAGNATTTAATGATATATATTCTTAACNGAACTCGGTNCCANTTTGTCCCA
CCCATGTCCAGTTGCAACTCAGCCACACCTCATCACACCAAACGCTGGTCACTTTATTAT
GGGACAAGTCGGNAGCAATNTCCTCGAAATAAAATAAAATGNACATTATTGGATGTACAT
TATTTTAATGCTGAGCCACCCGGGGTAATTNGNAACGGCAGGACTTTAGNACAGAGCCAA
TTACTCTAGNNGGAGTGAGCAGANCCNNNNACGGNGNNNNNGGNNNNNNNNNNNNNNGNA
NNNNNNNGNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnn

CLOSE