Detailed Information [105351]
 

Strain Information
DGRC Number 105351
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP7053 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP7053 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 77E6
Map Viewer
Related Genes CG3947 CG4289
Original Number 7053
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP7053

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 2009
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression weak
Larval GFP gut
Larval X-gal gut, mt, fb
Adult GFP abdomen
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np33405_0907
Strand Minus
Insertion Point 20696259
Chromosome Band 3L
Flanking Sequence
ggcggncccgcaaggnnaggnggtnngttttttgnnngactatnggggtnaaaaccaatt
ttgggaacttcggaaagcttcggctatcgacgggaccccttatgttatttcatcatgCCA
CAACTGCACCGATTTGATTACCTGTAGACCGAAACACCTCATTATTTTTATTATTTGGAG
GAACAGACAATATTTTCCGGATATAATGGACACTCTGAAGGGCATGCTGAAGGCGTACGA
GGCGTGGGTGGGCAAAAACCCCGACGTGGTGGGGGATTTTGAGACCACAGCCAAGTGGGT
ATCCTACTTTATAGCAGGTAAAGNGAACTCCTTGCTTACATAGAGCCTACAGACTCATCT
CATTGGCCGGCTTCCAGGTCGCATTTCCTCATCAAATGNGGGCAGGGAGCTGGNATATAC
ACTGGCAAACATGCTGGGGGTCTACAACGACCGGATCGNAGAANACNNAAGANAGAACCG
GGGGCAAAGAACCCANNANNGGNGGGGGNCGNNNNNNGGNAGGGNAANGCNNNCNANANG
GNAANNCCNNNNNNACCCANNNAANNCANGNNNAGNNANCCCGGCCNNAAAANNCCANCN
GNANNGGNGGGGNNNNANGNANGGGNCNNCNNNNNNAANCNNAANNGNNNANNNGGNNNN
GNCCNNNNGGNANNNNCCNNNNNNNNNGNNNNANANGGNNNNNNNNANNNNANGNNGGNN
NNAANGGNNNNGGGGNAANNAANNNNCANNGGANCCAANNNNNNNGGGNNNNNNNNNNNN
NNNNNNNNNNNGNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaaaaaa
aaaaaaaaaaan

CLOSE