Detailed Information [105374]
 

Strain Information
DGRC Number 105374
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP7126 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP7126 / FM7c
Break points/Insertion Site 15A1
Map Viewer
Related Genes CG13010 CG13012
Original Number 7126
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP7126

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 393
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression a small # of cells
Larval X-gal sg
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np04665_0711
Strand Minus
Insertion Point 16401994
Chromosome Band X
Flanking Sequence
ttntnaacgtgcactgcanttantgtatacttcggtaagcttcggctatcgacgggacca
ccttatgttatttcatcatgAGCCAATTAATAAGTGCGTCGACAGCGGCGGCAGCAGAGG
CAGCAGCGGTAGCAGCGGCAGCAGAGGCAGCGGCGGTAGCAGAGGCAGCGGCGGTAGCAG
TGACAGCGGCGGTAGCAGAGACAGCGACGGTAGCAGTGACAGCGGCGGCTATTGGCCAAC
CAAAGTTCGTTGCCGAGGCGGTGAAGTCGAGCGAGAAGTCGAGCGGGCTCTGCCGCGCTG
CGCATGCGCATGCGTCTGCGGTTTCTGCAACTGGGACAGTACAGTCGAAATTCCGCGGAG
CGAAATCAACCTGCACACTTCAAAATGTAGAAAACTCGAAATGTATATTTGCGAAATTTC
AACATTTCAATCAgatcgaagaatacataagagagaaccgtcgccaaagaacccattatt
gttgggggtccgttttcaggaaaggcaagccatccgacatgtcatcctctttcagaccaa
tcaaatccatgaagagcatcccctggggcataaaaatccaacggaattgtggaggttatt
atgatgagctgccgagttcaatcgatacaatcaactgnctttgacctttggttactnctc
tcttccgatgatgatgtcgcacttattctatgctgnctcaatggtnagaaggcatattaa
gtctccactgaagccatntttttntttngnnnnnntnnagnnggagtnntgnnattntnn
nnaatttnntnnnttttctnttttantnattnnnttgatcatttannttntnttcnttnn
ttnnnnntntnnnntncttnnntnntntnnnnntnnntnnntnnnnntnnnnnnnttnnn
nntntnntnntnnnnnnnnnnnntnngntnntnnnnnnnnnnnnnnnntnttnntnnnnn
nnnnnnnnnnt

CLOSE