Detailed Information [105433]

Strain Information
DGRC Number 105433
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP7341 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP7341 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 28E9
Map Viewer
Related Genes CG8486 CG8498
Original Number 7341
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP7341

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1105
General Information NP_lines
Embryonic Expression sg
Larval GFP pns
Larval X-gal sg
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np53485_0227
Flanking Sequence
GGGNNNNNNNNNGNNNNGGGGNNGGGGNNNNGGNNNNGGGGGGGGCNGGGCCCGCNGCCC
CNGGTTTTTTTTGGGGNNNGGGTNNNATNGGGGGGANNAAAANCCCGGGNTTTTTTGGGG
GGGNNNNNNNAAAAACCCCNNNNNNNNNNNNNNGGGNNNNNNNNNTTTTTGGGGNNNNNN
NNNNNNNNGGGGGGGGGGGGGGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNGGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNTTTT
TNNNNNNNNNNNNNNNNNNNNNNGGGGGGGGGGGGGGGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGGGGGGGGGGGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNG
NNNNNNNNNNNGNNNGGNGNNGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNGNNNNNNNNNGNNNNN
NNNNNGNNNGNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnngngnnnnnnnnn
nnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnnnngnnnn
nnnnnnnnnngnnnnnngnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnng
nngnnnnnngnnnnnnggnnnnnnnnnnnnnnnnnnngnggngnnnnnnnngnnnnggnn
nnggnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnnnngnnnnnnnngnngnnnnn
nnnnnnnnnnnnngnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnngnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnggngnngnnnnnnnnngn
nnnnnggnggnnnnnnnnnnnnnnnnnnnngnnngggnnnnnnnngnnnnngngnnnnnn
nnnnnngnngnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnngnggnn

Library Name / Clone Name np / np53245_0227
Strand Minus
Insertion Point 8154749
Chromosome Band 2L
Flanking Sequence
atttttngngtgcactgnntttaagtgtatacttcggtaagcttcggctatcgacgggac
caccttatgttatttcatcatgCTTCGAATCTTTTAAGTGTATAGGCTGCCAGACCCGCG
AAATAAAACGCAACAGCTTGTCCACTCTAAATTGAAAAACTGTTGGTCACACAAAAGTAT
AGACCAGATATCGATAGACGCCGATAGATTCGGTGAAGTAAAATCGTGCAATTTCTTTTC
CAAAGACTTCCACTAGTTAAAAAATAGATACAAAAATGTCCGAATTGCAGGTGAACTGAA
TCTACGTCAAATACGCATTCGTATCTTAAAGTCTGATTACCTATTCAAACTTAACCTAAA
CAGGAATTCAACCAGGCGGCCGAAGATGTTAAGAACCTAAACACCACACCCGGGGACAAT
GACCTTTTGGAGCTCTACAGCTTGTACAAACAGGCCACTGTGGGGGATTGCAATACAGGT
GGGTCTCGGACATAGTCGTCACTCCGCTGCACCATCGATAATTCTAATCCAATGCAGATA
AGCCCGGCTTTCTGGACTTCAAGGGCAAGGCCAAGTGGGAGGCGTGGAACAACCGCAAGG
GAATGAGCAATACCGACGCCCAGGCCGCCTACATTACCAAGGTCAAGGCACTgatcgaag
aatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaa
gggcaagccatncgacatgtcatnctcttcagaccaatcaaatncatgaagagcatccct
gggcataaaatccaacgggaattggnggagntatcatgatgagctggccgagtcaatcga
tacagtcaactgnctttgancctttggtactactctnttccgatggatgatgncgcactt
attctatgctggctan


CLOSE