Detailed Information [105442]

Strain Information
DGRC Number 105442
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP7379 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP7379 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 37F1
Map Viewer
Related Genes CG10337 TepIV
Original Number 7379
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP7379

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1245
General Information NP_lines
Embryonic Expression sg
Larval GFP sg
Larval X-gal gut (mg?)
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np06925_0711
Strand Plus
Insertion Point 19526381
Chromosome Band 2L
Flanking Sequence
GGGGGNANGNGNGTGTGTAGTTTNTTTGTNNGGANNCANACGGGNGTTCAATAAACCCGT
NACTTGGGNCTNNCGGTAAAGACTCCCGGCTATCGACGGGNACCACCTTTTTTTATTTCA
TCATGAGAGCGACATCTAACAAAACAACAACAGCTGACTCAGTAGAGAGCAGGAAAGAGT
TTTCGATATATATGTACACAACGCCTAGTCAGTTGGTCTCCGTATTTCGATTTAGGAGGC
AGTTCCGTTAACANTNNAAATCAACAAGTCCAAATAATATTGCACGCACGTNAGGGGCCA
CACGACAAAAACATAAATATTTGTATTCAATTCATATATTGGGATTTTACGCGAGATCGA
AGAATACATAAGAGAGAACCGTCGCCAAAGAACCCATTATTGTTGGGGTCCGTTTTCAGG
AAGGGCAAGCCATCCGACATGTCATCCTCTTCAGACCAATCAAATCCATGAAGAGCATCC
CTGGGCATAAAATCCAACGGAATTGTGGAGTTATCATGATGAGCTGCCGAGTCAATCGAT
ACAGTCAACTGTCTTTGACCTTTGTTACTACTCTCTTCCGATGATGATGTCGCACTTATT
CTATGCTGTCTCAATGTTAGAGGCATATCAGTCTCCACTGAGCATNNNNNNTNGGGGGNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGNNNNNN
NNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE