Detailed Information [105448]
 

Strain Information
DGRC Number 105448
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}CG34360[NP7418] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}CG34360NP7418 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 85F1
Map Viewer
Related Genes CG12802 CG32469
Original Number 7418
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP7418

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1419
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression gut
Larval X-gal sg, tr (all), epi
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np40105_0907
Strand Minus
Insertion Point 5754650
Chromosome Band 3R
Flanking Sequence
gnnnngnngnggngngnnnnnnnnagggggnnnngnnngngntnngtttttttngnnngg
ganntaaacnggtgggncanananccctcttttttgtgacttncggtaagactncggcta
tcgacgggaccaccttatgttatttcatcatgCTGTGCGCTGAAATCGCCGCGAAATCGC
CGGTTTTCGTACTTCGGCTGGCGTTCGGCTTTTGCACTCGGCTCGCTCTCTCAATTTTCG
CGACTGCGCTCTCTTGCGTCCATTTTCCGGTTTCTCACAACGTTTGTTTTTGTTCCTCTG
CTTTGTGCTGGCCTTTCGCATGCTTTGCCGCAGCGCTCTCTTTCACACCAAAAAGGGGGT
GAGAAGTGTGTGGCGCACTCTCTCCCCCGCAAAAAGAGCGGATTTACGTAACTCAAAGAT
ACAAGTGATATCCAGTATCTTGAGTCTTTTCGCTGGCATCGCGTTGAAAAATAAAAAACT
GGCTTTTCTTTCGTTTGCCGATCNNANANTACATAAGANAGAACCGTANNNNNNGAACCC
ATNTATNGTAGGNGANCGATCTCAGGAAGGGNAANCCATNCNACANGANANCCNCTANNG
ACCAATCAAATCCATGAANAGCATCCCTGGNNATAAAAGCCAACGGAATGGTGGAGTNAT
CATGATGAGCTGNCNNGACANTNGATTCAGTCAACTGTNTTTGACCTTTGTNACTACTCT
CTNGNGATGATGACGTCANACTTATNCTATGCTGACNANNTGCNNNANGCATNTCAGTCT
ACACTGAGCANNNNNNNNNNngggggggggggggnaaaaaaaaaggggccccnncnnaaa
ngnccaacntnnnntnaactngnaaanagaantntggnnnnnntannnnnngnnnngnan
nnnnnccntnnnnnnnngnacccnnnnnncnaaanaaacccnnttnttnggnngggggnn
ccnnnttttnanggnanggggnaaanncccntnccnnnnatn

CLOSE