Detailed Information [105468]
 

Strain Information
DGRC Number 105468
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}Atg2[NP7457] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}Atg2NP7457 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 62F3
Map Viewer
Related Genes CG12093 CG1241 mRpS28
Original Number 7457
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP7457

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1757
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Larval X-gal sg, cns, tr (all)
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np40395_0907
Strand Minus
Insertion Point 2755026
Chromosome Band 3L
Flanking Sequence
cgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccaccttat
gttatttcatcatgCAAGTGACCATCAAGTTGGCCCTTGTTCTTCTTCTTTTTGTAGCTG
CGACCAGTGTGGCCAGGTGTGGGCACTTCGTAAAATACCCCCTGGTGTGTGCAATGCGGG
GGAGCGTTCGCAGGGGGCATTTGAAAATAAAATGATTTATTATTATGAGCCGATTTCTGG
TGAGTAATTTGTCATTTAACCTTAGAATCCAGTCTGAATATTTCAAATATACATTGATTT
CCTTTTAAATCTGCTTGATTTAAGTAGTCATTTTAAATTAACTTTATTTACTTTAATTTG
GCGTAAATAATTTTAATTTAGTTATTAAAACAACACATAATTATCATCGGAGATTTATGC
AAACTCCAAACAACCTGTTGCTACCCTGCAACAAAGTCATGCTTTGACCAGTGTTGAAAA
ACGCAGCTCCACAGCTGTTTTGCCAAGTTCTTAATTATATTTTTGTTTGCTTATTTTGCG
CTTTTGTTTTTCTTTTGCTTGCAATTATTATGTTTATTTGGCATTACTTGACCCTCTTGT
GCCTTGGGTTCGCCCTCATCGATGCGAAATCCATCAAGAAGTCGCAAGCCAATCTGTTGG
AGCCAACTCTTGATCGAAGAATNCATAAGAGAGAACCGTCGCCAAAGAACCCATTATTGG
TNGGGGTNCCGTTTTCANGGAAGGGCAAGCCATTCCGACATGTCATTCCTNTTTAGACCA
ATCAAATNCATGGAAGAGCAtncctgggcataaaatccaacgggaattgnnggagttatn
atgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttgttacct

CLOSE