Detailed Information [105470]
 

Strain Information
DGRC Number 105470
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP7459 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP7459 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 93F14
Map Viewer
Related Genes how pit
Original Number 7459
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP7459

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1588
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality semi lethal
Embryonic Expression muscle
Larval X-gal sg, epi, mt
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np41825_0907
Strand Plus
Insertion Point 17858857
Chromosome Band 3R
Flanking Sequence
anntttnggggnaaaanccccnttttttntnctncggtaagctncggctatcgacgggac
caccttatgttatttcatcatgGTTTTGTGCTCTTCGCTTCGCATTCAGTTTCTTTTTCT
CTTTCTTTGCGCACGGTTCAGTGGTAGGAAAATTAGGAGGAATCGTTCAGTAAAGTCCCG
Agatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgt
tttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaag
agcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtc
aatcgatacagacaactgtctttgacctttgttactactctcttccgatgatgatgtcgc
acttattctatgctgtctcaatgttagaggcatatcagtctccactgaagccaatcttat
tctggactncanntnttnnnntgntgaacgtcgcncntnctncnaccctnnnntcctggg
tngaggnanntnaggcctccnactgnagaccantctnntttncattcntntnnnnnnnna
tntncngnnttnactgnttnttngncccnnnnnnnannnnnccnntccnnnnnnannncc
tnnnnnnannacccnnnnnccnnnnnacccccttnttngnnnggggnnccttnttnnnng
canggnnnnnncntncnncnnnnnncnnncnntntnnnnncccnnnnnnnnccnnnnnnn
nnncntccccttnnncnttnnncncnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnc
nnnccnnntncntnnnnnncncnncccnnnnttnnnnnttnnnccttttnnnnccncnnn
ntntccnnnnnnnncnnnnnncnnntnnnnnttnnccnncccaacnnnaan

CLOSE