Detailed Information [105479]

Strain Information
DGRC Number 105479
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}Dlc90F[NP7472] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}Dlc90FNP7472 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 91A2
Map Viewer
Related Genes Dlc90F CG18600 l(3)05822
Original Number 7472
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP7472

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1533
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np69595_0810
Strand Plus
Insertion Point 14125182
Chromosome Band 3R
Flanking Sequence
atntnttgggcgtgacantcgctantttntttgtntacttncggtaagcttcggctatcg
acgggnaccaccttatgttatttcatcatgGCCAGTTCATTGTGGACGACGTGAGCAAGN
ACGATTAAAGTAGGCCATCGAGACGACCATCGGCGGTAACGCCTACCAGCACGACAAGGT
GAACAACTGGACCGGCCAGGTGGTGGAGAACTGCCTGACGGTGCTCACCAAGGAGCAGAA
GCCCTACAAGTACATTGTGACCGCCATgatcgaagaatacataagagagaaccgtcgcca
aagaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcc
tcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtg
gagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttgtta
ctactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcata
tcagtctccactngctnnnnnnnnnnnggggggnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE