Strain Information | |
---|---|
DGRC Number | 109717 |
Genotype with FlyBase Link | w[1118]; PBac{EGFP-IV}CG33129[KM0010] |
Genotype | w1118; PBac{EGFP-IV}CG33129KM0010 |
Break points/Insertion Site | 32C1 |
Related Genes | CG33129 |
Received Date | 22 November 2012 |
Original Number | 10 |
Chromosome | 2L |
Comments | Expression Photo: KM0010 |
Original Source | Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology |
Original Comments | Insertion site: 2L:10967858 (based on Drosophila melanogaster genome annotation release 5) Cytological map: 32C1 Inserted gene: CG33129 Protein trap?: Yes Insertion into Intron or Exon?: Intron(CDS/5'UTR) Orientation of piggyTrap (F:Forward/R:Reverse): F Orientation of GFP exon and its frame against inserted gene: same orientation and frame(coding intron), correct frame but premature stop(5'UTR Intron) |
General Information | Kyoto_piggyTrap |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
|
Stock Request |
Library & Clone Information |
---|
Insertion Point | 2L:10967858 |
Chromosome Band | 32C1 |
Flanking Sequence | GCTTGCCCTTTTGNTATCTGTAAGGAAGAAAAAATTAGCTGCAGATAAATAAACCTCGAT ATACAGACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAACGTACGTCGC AATATGATTATCTTTCTAGGGTTAATTTATGCTCACTCCAGGCTTCAAAAGCCAGTTGAA TAGCGGGGAGAAATTTCGGACGAACGCCGGCTAACGCTTTCCATCTCTTTCCCGCAGCCG ACCGTCGCCGTTGGC |
Sequence Comment | iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5. |