Strain Information | |
---|---|
DGRC Number | 109730 |
Genotype with FlyBase Link | w[1118]; PBac{EGFP-IV}mub[KM0121] / TM6C, Sb[1] |
Genotype | w1118; PBac{EGFP-IV}mubKM0121 / TM6C, Sb1 |
Break points/Insertion Site | 79A3 |
Related Genes | mub |
Received Date | 22 November 2012 |
Original Number | 121 |
Chromosome | 3L |
Original Source | Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology |
Original Comments | Insertion site: 3L:21896719 (based on Drosophila melanogaster genome annotation release 5) Cytological map: 79A3 Inserted gene: mub Protein trap?: No Insertion into Intron or Exon?: Intron (5'UTR) Orientation of piggyTrap (F:Forward/R:Reverse): R Orientation of GFP exon and its frame against inserted gene: same orientation but wrong frame, premature stop |
General Information | Kyoto_piggyTrap |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Lethality | lethal |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
|
Stock Request |
Library & Clone Information |
---|
Insertion Point | 3L:21896719 |
Chromosome Band | 79A3 |
Flanking Sequence | ttaataacatttcggtcatgatttag |
Sequence Comment | iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5. |