Detailed Information [109730]
 

Strain Information
DGRC Number 109730
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}mub[KM0121] / TM6C, Sb[1]
Genotype w1118; PBac{EGFP-IV}mubKM0121 / TM6C, Sb1
Break points/Insertion Site 79A3
Related Genes mub
Received Date 22 November 2012
Original Number 121
Chromosome 3L
Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 3L:21896719 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 79A3
Inserted gene: mub
Protein trap?: No
Insertion into Intron or Exon?: Intron (5'UTR)
Orientation of piggyTrap (F:Forward/R:Reverse): R
Orientation of GFP exon and its frame against inserted gene: same orientation but wrong frame, premature stop
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Insertion Point 3L:21896719
Chromosome Band 79A3
Flanking Sequence
ttaataacatttcggtcatgatttag
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE