Detailed Information [109742]
 

Strain Information
DGRC Number 109742
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}nudC[KM0102]
Genotype w1118; PBac{EGFP-IV}nudCKM0102
Break points/Insertion Site 73D1
Related Genes nudC
Received Date 22 November 2012
Original Number 102
Chromosome 3L
Comments Expression Photo: KM0102

Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 3L:16808070 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 73D1
Inserted gene: nudC
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): R
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Insertion Point 3L:16808070
Chromosome Band 73D1
Flanking Sequence
GNTTTNCTNGTNGCCNNNTCTTTTNGGTGAGGCNGANAANTTAGCTGCAGATAAATAAAC
CTCGATATACAGACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAACGTA
CGTCGCAATATGATTATCTTTCTAGGGTTAAACTTTCAAATAACTCAAGAGAATAGTTAT
TTCTAAAACTATTTGACCTGATCTTAAAACTAAATTCCCAACCAGGAAACTGAGATCTTA
GAGGCGGTTAGTTAA
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE