Detailed Information [112009]

Strain Information
DGRC Number 112009
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Fer1HCH[NP0019] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype w*; P{w+mW.hs=GawB}Fer1HCHNP0019 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 99F2
Map Viewer
Related Genes Fer2LCH Fer1HCH 412{}1459
Original Number 19
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP0019

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1687
General Information NP_lines
Embryonic Expression pns subset (ch)
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np51815_0227
Strand Minus
Insertion Point 26202159
Chromosome Band 3R
Flanking Sequence
agtttttcgtgcactgaanttaagtntatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgTGGTGAACCATGCTTTTTGCACACGGCACTACACGAAAA
CAAATGCCGTTACTATGGCGGCGAGAGCTGCGCACGTTACCAATGCAGTTACAAAAACAG
AGAGAGAGAGAGTGGGAGAGTAGGCCATTACAGTTTTGCACACGGTTTTTGTGCCCTAGA
ATAGCGGCATTTCAAGCGCAATTTCAAAGGTTTATGCAATTACGCCCTCTTAAATGCAAT
AACCAACAACGCCCTACCCCTCAGCCAAGCAAGAAAGCAAGAGTTTCGTGAGAGAACTGC
AAAGGGAGCGAGAAGAGCATCAACTAAAAGAAAAACAAAACCTAAGCCATGAAGGTCAAG
ACCAAGAGTGCAAAGGTTTTTAAAATATTAAAATTTACCTAAGTTCTGATTACAAAAATA
AATTTTTTAAAGCTGAATACTAGCCATATATTGTTATCGTGGTCCCCCGACTTAACCCAA
CCTTATCCCATTGCAGGCTCCCTGGCTGTTCCTGAGATTACCAAGGACTGGGTGGACATG
AAGGATGCCTGCATAAAGGGCATGCGGAACCAGATCNANGAGNACATAAGAGANTACCGC
CNNCAANGNACCCATTATTGNTGGGGTNCGTTTTANGAGGGCANGCCNTNNACATGTNAT
CCTTTTTANACCNTCAAATNCATGGAGAGCNTCCNNGGNATAAAATNCACGGNATTGNNG
NGTTATCANGANNNGCTNCCnngtaatcnntacannnaactgnttngccttngnactnct
ntnttnnaaganangnnnacttatttttgctgttnatgntagnggnatntannntcatga
cnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE