Detailed Information [112017]

Strain Information
DGRC Number 112017
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}CG13004[NP0038] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}CG13004NP0038 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 15A11
Map Viewer
Related Genes CG13004 RSG7 CR32565
Original Number 38
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0038

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 398
General Information NP_lines
Embryonic Expression cns subset (TU), uni epi (SG)
Larval GFP mt
Larval X-gal fb, gut, epi
Adult GFP abdomen
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np05035_0711
Strand Plus
Insertion Point 16566531
Chromosome Band X
Flanking Sequence
ntnctttgggtgcactgaannttatnttttatacttncggtaagncttcggctatcgacg
ggaccaccttntgttatttcatcatgGACTGGCAGATTGCAAACATCGCTGCCAGCGCCT
CGCTTTCCGCTGACGACGTCGACTGAGGCGGCGGCGTTTGTTATTGCTTTTGTTGCGGCT
CGCGAAGATGCTCTCCACTCTCCGCTCTCCAATCTTCGCACCANANATGTTGCAACTGCT
CGGGAACAAATATAAGTAGTCAATGTAACTGCAAATATAATTTAAAAgatcgaagaatac
ataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggca
agccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggca
taaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagnca
actgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgct
gtctcaatgttagaggcatatcagctccagctcnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)


CLOSE