Detailed Information [112041]

Strain Information
DGRC Number 112041
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}NP0092 / FM7c
Genotype w* P{w+mW.hs=GawB}NP0092 / FM7c
Break points/Insertion Site 7B6
Map Viewer
Related Genes ct CHES-1-like
Original Number 92
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP0092

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 202
General Information NP_lines
Embryonic Expression sg
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np52115_0227
Strand Plus
Insertion Point 7420412
Chromosome Band X
Flanking Sequence
attttcgtgcactgaanttaagtgtatacttcggtaagcttcggctatcgacgggaccac
cttatgttatttcatcatgTTACGGGCGATTCCGGGGAGAGCGTGCAGTTGTGAGAGTGG
AGAGTTCACAAGGAGGTGACAAAGAGAATGAGTTTACGGTTATTCAGGTTGGGTTTGCGA
GCTCCAATGTTGTGTCACCTGCAAAACTGTATCCgatcgaagaatacataagagagaacc
gtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatccgacat
gtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacgg
aattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacc
tttgttactactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttag
aggcatatcagtctccactgagntntnnttnntnggggnnnnnnnnnnnnnnnnnnnnnn
nannnnnnncannnnantgnnttngnccttngnnactactntnttncgatgatgatgncn
acttattntatgctgnntnaatgnnagaggcatatnannctncactgaagccatnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnn


CLOSE