Detailed Information [112059]
Strain Information
DGRC Number 112059
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}NP0144 / FM7c
w* P{w+mW.hs=GawB}NP0144 / FM7c
Break points/Insertion Site 71D1
Map Viewer
Related Genes Toll-6 CG7804 opus{}1007
Original Number 144
Chromosome 1
Comments NP line. Received from the National Institute of Genetics.
Balancer FM7c
Cluster id 1918
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression a small # of cells
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2019-04-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]

Library & Clone Information
Library Name / Clone Name np / np54533_0309
Flanking Sequence
GNNGGNNGAAGGGNGGGGGGNGGGGGGGGGGCNNNACGNGNGGGGACNNNCNTTTTGGGG
GAAAANACNGCCANCNGNTGNCGCACACNCGGGGAAGGGCGAGGAGNCNGAAGGGGGANT
ANGNTCGNAGNGGGNGGGAGAANNNGGGNGCAGGGCGCCNCNNANNNCCACACGGANGCA
AAGATCGNATNCCATCAGNAGGANGAGGCCCCCNTCCGNNGNAGNCAGNAGANNNAGGGC
CCAAGNNNCNACCGNNGNAGGGGCNGANGGAGNNACNCNACANGNNNGCNNGNNNAAGCA
AACCACGAANNCACACTCNGCACGGGGGCAACGTACCACNAGNATNNGGNNANNNAAGAA
AAGNNCCNNGANCGNNGGGGTGGAGNNGCNNNNTGCGNNGGGNANNGAGGGAAAANGAGN
GTNGAGNNGGACCNACACNAGTATNNANNAANCAGCNAGNAANAANNNCNNAGGCGANNG
ANNNGAAGGCGAGAANGGAAGGNANANANGGNGNGGNGNAGGNACGCCNNNGTGTANNCG
ANGAAACNGNNANNGNAGANGAGNGGAANNNNACGGCANNTNNACCTNCGGNGAAAAAAC
NGNNNCCAAAANCGGGANANACGNNNGANANAANANTGGAAAAGNGNGNNGCGATNCNCG
NAANCNACGGGAAAGNGGCGGAGGAGCGGCATCNANCGAAGAAACNCNTGANNGGAACAN
GGGAANGGGGNCAANGNTACAANGGNGANANNNNNGNGGGGACGNANNGGGNNGGCGGAA
AANNACGANGCGTACNGCGNagnngnccgnnaggntncggaagnnggnacgnanagaaaa
ggnagaggggaagagnggaacnggggggggngagaacgggggaggaggaagaggnggcnc
gaagagggaggtgancgagaacgggagnganangagggancggnggggnacagnacannc
naaanggngtgnagaaatagaataagngggaacaagcntagggngaggcgaccgcaaccn
cgantgnnagangngaagggangcnaggggnacggnngggggncgnnagagngngnctgn
ganagatncgagnnataaccgaaatgtgggaanaannacacnnaanantcntngnaggag
agatnnacgnnnngnacanganngancngnggaggagnnnaannagganacggagngnga
ngaacnagntnnagagacaggagancagngnngngntnnncgnaganacgannaagnnan
gggaganacgngnnanngnnanaggagcgaggcgnatganngcngngcggangacgagac
naaaaaagnaggnggacgcggagngcnntnaaacgancnnacacgcnnganntnataaga
tatggnatanntagntagagngncangcacnnnnaannatcnataganaaggngncgncg
anggagccnnacggtnagaaggnngggggannnccgangncccgccccaacnnngcngcn
gcntnnngaaaaannnantnngnccgnaggcgggacggcgtacnnacganggncnangnt
ncgnacgacntg

Library Name / Clone Name np / np04105_0711
Strand Plus
Insertion Point 15372723
Chromosome Band 3L
Flanking Sequence
antcttggtgcctgnctttatttgtatacttcggtaagcttcggctatcgacgggaccac
cttatgttatttcatcatgGTCAGGACTCACCAGCGCTCGGCTCTCGTGTTTTCGGGCCC
CGTCAGCAGGCGACTCGGGGCCTGTCTAGGAACATGTTTGTGTATGTGTGCATTCGGAAC
AAGTGCCGTTGGTCGCACTCAGGGTGAGGGGTCAACNTTTNGAAGCGGATATAAAAGCAG
CGGGGCGGGAGAAGAGGCCCCAGTCTCGAACGGACACATAACGGAACCGCTAGCAgatcg
aagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcag
gaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatc
cctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcga
tacagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttat
tctatgctgtctcaatgttagaggcatatcagtctccactgagccatttnnntttnnggn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnn

Image Files
Disc

d1 (->Large)

d2 (->Large)

CLOSE