Detailed Information [112089]

Strain Information
DGRC Number 112089
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP0212 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}NP0212 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 22A3
Map Viewer
Related Genes CG14351 Or22b F-element{}287
Original Number 212
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0212

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 991
General Information NP_lines
Embryonic Expression muscle subset, sg
Larval GFP fb
Larval X-gal sg, epi
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np04365_0711
Strand Plus
Insertion Point 1556757
Chromosome Band 2L
Flanking Sequence
accncctgnggggaaaaaaccccccnccttngnactncggaaagaccccggctatcgacg
ggaccaccttatgttatttcatcatgGGCTGGAGCTCGATTTTAGAGCCCCGATTCTTGG
CTTTCAGTCACCTGTTAAGGCCCAAGCGCTACGAACGTTGACGGAGTTTTTCCGGGAAAT
CGCCAGAGGAAAATCACGAGAGTGCGTGTGNGTGATCNAANATTTTTTTTNAGAGAACCG
ACGNCAAAGAACCCANNATCGGNCGGNGCACCGGGCANCAGGAAGGGCAAGCCATCCGAC
ANGGCANNCNATNNAGACCAATNAAATNCATGAAGAGCAANCCTGGGCATAAAATCCAAC
GGAATTGGNGAGNNATCATGAACGAGCTGCCGAGTCAATCGATACAGTCAACTGACCNCG
ACCTGAGGTACTACTCTCTTACGANGANGATGNNGCACTTATGCTATGCTGTCNCAACNG
GTAAGAGGCATATNAACACTCCACTGAAGCCAATCNAATNNGNNCTNNNNATNNNGGNNN
ACCCGGANGGCGGNNGNNNNATNNGGNNNNCCNNGCCNGGNNNGGNNNNNNNGNNNNNGN
NGNNNCCNAGNNGGNCAGNNNCANNNGNANCNNGCNNNNNNGGGGNNNANNNNANAAAGN
CNGNNAACCCAANGNNNNNNNCCNNNNNNNNNCNNNNNNGGNNNNNNNNNNNCNNNNNNN
NNNACCNNNNNNNANNNANCCNNNNNNNNNNGNNNNCNNNNNNNNGNNGNNNNNCNNNNN
NNNNNNNNNNNNNNNNNNNCnnnnnnannnnnnnnnnnnnncnnggnnnananncnnnnn
nnnnnngnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnaaagaaaag


CLOSE