Detailed Information [112114]

Strain Information
DGRC Number 112114
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}spi[NP0261] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}spiNP0261 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 37F2
Map Viewer
Related Genes spi msb1l
Original Number 261
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0261

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1246
General Information NP_lines
Lethality lethal
Embryonic Expression v. mesoderm, good driver
Larval GFP fb, tr
Larval X-gal sg, dots on gut
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np05365_0711
Strand Plus
Insertion Point 19553655
Chromosome Band 2L
Flanking Sequence
nntcttcgtgcactgaanttaattttatacttncggtaagncttcggctatcgacgggna
ccaccttatgttatttcatcatgGGCTGGGAATTCGAATAAGAGCGGAGCGCGTCGCATT
CGGATGTTCCGATTCCCCATCGTTCCCAGCCGCAAAGCGGTCAGCGTTCCAATGCCAACG
GCACAGTGGTTGCGATGCGTAAGGTAACGTGCTACGGAACCGAAACTCGCGGATgatcga
agaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcagg
aagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatcc
ctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgat
acagtcaactgtctttgacctttgttactactctcttncgatgatgatgtcgcacttatt
ctatgctgtctcaatgttagaggcatatcagtctccactgagcattttntnntngggnnn
nnnnnnnnnnnnannnnnnnannngcntncntngnnntnnnnnncannnnantngnnnnn
nnnnnatgannanctnncannnnnntnnnnncnnnnaantgnnnnnnnncttnnnnacna
cnnnntnnnnnnnnnangnnnnnnttntnnnntnnnnnnnnangnnnnangnntnnnnnn
ntnnanngaancannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)


CLOSE