Detailed Information [112163]
Strain Information
DGRC Number 112163
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP0384 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
y* w*; P{w+mW.hs=GawB}NP0384 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 87A3
Map Viewer
Related Genes Hsp70Ab Hsp70Aa CG3281 S-element{}1293
Original Number 384
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP0384

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1451
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression a small # of cells
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np41935_0907
Flanking Sequence
gtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccaccttatg
ttatttcatcatgATGAACGCCTCATCGGCgatcgaagaatacataagagagaaccgtcg
ccaaagaacccattattgttggggtccgttttnaggaagggcaagccatccgacatgtca
tcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaatt
gtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttg
ttactactctctttccgatgatgatgtcgcacttatttctatgctgtctcaatgttagag
gcatatcagtctccactgaagccatcttntnttgggantaatnnnttccgnnnaaaangt
ngaagcannttaatnctcnctgaaagccatnnnnttnnnnnnncnncantgaanccaatn
nnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np65223_0309
Strand Plus
Insertion Point 7783765
Chromosome Band 3R
Flanking Sequence
ttgcntgcgcacttnntgcagtctgacgttagtggntgtctcttgccgncgggcaccacc
ttatgttatttcatcatCATATTTCATAAAAAAATTGCGTTTAATTAAACAAATAACCCC
TTATTTTGACCTTTAAAGTCAAAAATTCAACTTATTTCACGGTGNGTAAACAGTTTNTTG
ACAAACTGTATGCCGAATGGGCATTTATTGGTTTATTGGATTGGCTGCGCCGAAAAATAA
GCCATAGTCGGCACCATAAGCATAACCTAGCTCTGCGATTATCTCTAACATAATTAACTT
AAGCAGCCGTATTTATAAAGAAATTTCCAAAATAAAGCGAATATTCTAGAATCCCAAAAC
AAACTGGTTGTTGCGGTAGGTCATTTGTTTGGCAGAAAGAAAACTCGAGAAATTTCTCTG
GCCGGTATTCTCTATTCGTTTTGNGACTCTCCCTCTTTGTACTATTGCTCTCTCACTCTG
TCACACAGNAAACGGCGCACTGTTCTNGTTGCTTNGAGAGAGCGCGCCTCGAATGTTCGC
GAAAAGAGCGCCGGAGTATAAATAGAGGAGCTTNGTCGACGGAGAGTCAATTNTATTCAA
ACAAGCAAAGNGAACACATCGCTTAGCGAAAGCTAAGCAAACAAACAAGCGCAGCTGAAC
AAGCTAAACAATCTGCAATAAAGNGCAAGGTTNAAGGGGANTCAATTTAAAAGTACCCCN
CACCCCNGTNATTAAACTAAAAACTGCNNCTTCTGGAATNAACCCNGAAGNNATTTTTGN
GGACNAGANAAGAACCTGAAactttnaacaagnngttncnnggagaaaaantcaccccaa
ngncctgntttggnaannancnnncncncngnnttggncnnnnnnnnnnnnnnnnnnnat
nn

CLOSE