Detailed Information [112197]

Strain Information
DGRC Number 112197
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP0523 / TM3, Ser[1]
Genotype w*; P{w+mW.hs=GawB}NP0523 / TM3, Ser1
Break points/Insertion Site 87A3
Map Viewer
Related Genes Hsp70Ab Hsp70Aa CG3281 S-element{}1293
Original Number 523
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP0523

NP line. Received from the National Institute of Genetics.

Balancer TM3 Ser
Cluster id 1451
General Information NP_lines
Embryonic Expression muscle
Larval GFP ubiquitous
Larval X-gal gut, epi
Adult GFP abdomen
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np10465_0727
Strand Plus
Insertion Point 7784117
Chromosome Band 3R
Flanking Sequence
atttttgngtgcactgantttaantgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgCTCTATTCGTTTTGTGACTCTCCCTCTCTGTACTATTGC
TCTCTCACTCTGTCGCACAGTAAACGGCACACTATTCTCGTTGCTTCGAGAGAGCGCGCC
TCGAATGTTCGCGAAAAGAGCGCCGGAGTATAAATAGAGGCGCTTCGTCGACGGAGCGTC
AATTCAATTCAAACAAGCAAAGTGAACACATCGCGAAGCGTAAGCTGAGCAAACAAACAA
GGCGGCAGCTGAACAAGCTAAACAATCTGCAATAAAGTGCAAGTTAAAGTGAATNAATTA
AAAGNAACCAACAACCAAGTAATTAAACTAAAAACTGCNTCTACTGAANTCAACCAAGAA
GTCATTATTGAAGACAAGAANAGAACTCTGANTNGGTCGATAGCGTCAATGTCCGNCTTC
AGTTGCACTTTGTCAGCGGTTNCNTGACGAAGCTCCAAGCGGNTTACGCCATCAATTAAA
CACAAAGGGCTGTGCCAAAACTCCTCTCGCTTNTTATTTNTGATTGCTNTTAGAGTGATT
GGGGTGGCGATNGGNTTTGGGNNNNGNTTANNANNNNNNNAAAANTNATNNNNNNAANNT
TTNATNCNTTANNCNTNNNCNTGGNGGGGGNTTTTNANGGNAATTGNTTNTTTNATNACN
NNNCNNNCTNNAAGATNTNNNTTTTTTNAATNNTNNCTNTANCNACNANCCNNNAATTNG
GNANAAANNTNCNNGGGGNCnaannnnnnnngnannttntnannntncttnggnannaaa
nnnnnnggnnnnnnttttttnaaaacccttnnagnnnnnannnnggnnaanaaancnnnn
ttnggnnncaannnnncn

Image Files
Disc

d1 (->Large)


CLOSE