Detailed Information [112204]
 

Strain Information
DGRC Number 112204
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP0534 / TM3, Ser[1]
Genotype w*; P{w+mW.hs=GawB}NP0534 / TM3, Ser1
Break points/Insertion Site 63C1
Map Viewer
Related Genes CG12078 CG14959
Original Number 534
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP0534

NP line. Received from the National Institute of Genetics.

Balancer CyO;TM3 Ser
Cluster id 1762
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression a small # of cells, sg
Larval GFP sg
Larval X-gal sg,
Adult GFP abdomen
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np10485_0727
Strand Plus
Insertion Point 3231241
Chromosome Band 3L
Flanking Sequence
atnttttngtgcctgaatttaagtgtatacttcggtaagcttcggctatcgacgggacca
ccttatgttatttcatcatgGGCTCTACGAGTTTGCTATATATACGCAGCGCAATCAGTT
GCGAGGCAGCACTCGTTCCATTTGGGCGCTCGACAATCGCCCGCTgatcgaagaatacat
aagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaag
ccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcata
aaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaac
tgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgctgt
ctcaatgttagaggcatatcagtctccactgagcatctttttttttgggnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

CLOSE