Detailed Information [112228]

Strain Information
DGRC Number 112228
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP0577 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP0577 / FM7c
Original Number 577
Chromosome 1
Comments NP line. Received from the National Institute of Genetics.
Balancer FM7c
General Information NP_lines
Embryonic Expression cns
Larval GFP sg
Larval X-gal sg
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Okamoto N, Nishimura T.
Signaling from Glia and Cholinergic Neurons Controls Nutrient-Dependent Production of an Insulin-like Peptide for Drosophila Body Growth.
Dev. Cell (2015) 35(3) 295-310 [PubMed ID = 26555050] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np10605_0727
Flanking Sequence
nnntttnngtgcactgantttaagtgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgAACTGAACTGAAGCCGCCGACAAAACGAAgatcgaagaa
tacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagg
gcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgg
gcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacag
tcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattctat
gctgtctcaatgttagaggcatatcagtctccactgagccatcttttttttggggnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np56163_0309
Flanking Sequence
GNNGAGGGGGGGGNGGGGNGNGGGGTTTGTGGGGGAANTTNTCTNGGCNTTATGNCAGNC
TTNCNTNAANTGGNGGNTTCTTTGNGCNGNGGGACCCCCTNTATNNTNTTNTANNATGGG
CANGNGCGANGGCTACANCTANNTGNNNCNGAGNNTNCANCTGCATCAANCANTAGCNNC
NNNAAGATANTCTNNANAGGNGANTNGNNNANTATTGGNNCCANNTNTANATGCCNNCNA
NNNAGNGACCNNGNTATTNTAANNTNAGATTGTNTTGGNNATNNNTNCCNTTNNACCCNC
GNNNTCNNNNGCGACATTGNCCGACTNTNNCNNNNNTNTTTNANCGAGNNNNCTNNNCTT
CNNCNCNCNCTNTNNCGTNTGCCNTCNCCNCNTGTGTNNNTTTNATTATTCGTCANNNNN
CNNTATCCNACANCNTCTTANGGCTNNNANGNTAACNNGGNANCTGTANCGAGTNNGATA
TNAGNTGTTCTNTNTATNTCGCTNTNNAATNNNNNTTTNTNCANNNATCCNNTTNTNNTG
TTANTCTNCNNNTNNTNNGNNATCTTNTNNNNCNTNANGTCGCTNNTGTAANAGNACNNN
AGCGNNNNTATGANTACACNNNNAGNTNTGNNTTGNACNCNNTTNTCNCCTTNTNTGTAN
CANNCNTCTNTNNANTNNTNTCTCAGNCNANNGNNGTNAGNTGNCTTANAANNACNTAAA
AANANNNNNCGNTCTNNNTGTNGNTAGTGNCCTCCNTNNTGTANANNCTGGTNNGAGNNA
CNNANCTNNCACCTNCANCNgacntntgcggatctatatnngngngnntntngatgttgn
antnnantgnctnntgtgttcanttaancntgaaagnncnctnnnnnnncnnaaaannan
cccgcnanccnggngtacttnncnccgtnctcnncgacncnctcgtcncgcnngcctnnn
gcnnncgtgnnngttctnntntannnagatngtcnnnnntttgnaactnntctnanctct
gngnatnantntnnanttnnncttnctcttnnntttcnnnatannantanctgngtgann
aacgnaaatncgagnntcncnaaccttaatnacnntacttngtnanttagncaacntngg
anntaanaancntataantantnctnttnnntaacgncgntgacaccnnnngatcnacnc
tcnntnnaatttntcttctgnnntcntnnnnttgnnannnntnanctnattgatagtcgn
acnnnnnntnncacnntnnncacacaagnatnggnnantnnatcnntgnctaatgccnca
ccganggacnancaccnttnctnatncttcgcnanatannaagnancggtngtgatntgn
ntngnagnncacgangttnacagtatatgnntcnagncanntatgtcgnctnnttttnnt
ccngnnnnntnattcatagtnncannantangnacnancgncnccgnnngngncanacgn
c


CLOSE