Detailed Information [112408]
 

Strain Information
DGRC Number 112408
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP0939 / TM3, Ser[1]
Genotype w*; P{w+mW.hs=GawB}NP0939 / TM3, Ser1
Original Number 939
Chromosome 3
Comments NP line. Received from the National Institute of Genetics.
Balancer TM3 Ser
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression muscle
Larval X-gal epi, mt, sg
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np10935_0727
Flanking Sequence
anttnttggnnnggtccccactntnggaattncccccttnnntgggggnncggaaanacc
ccggctntngacggggaccaccttatnttgtttcatcatgCTNTGAACNTGCAGCGCTCT
CTGCGNTCTGANAGAACCATGTGCGCCCTGCCTCCGTGTNTTGGTGNCGNTCGTCNTCTC
NTATGTTTTGGNCCNNCGGNCGNNCNNNCTTNNNCNGTCCCGNGCNNCCNNCTTNANGAA
AAAANNTTTTTTTTTTGCGGCGGNGGCNCNNTNNGGGCCGGGGNGGTNNNTNNTCTNNNC
NTTNCCCCGCNNCCCGCNCCTCNGTNCTCTGTCCCGCNCGCTTCCNCNCCTCGTGCCCNC
GTGNTNCNCGCCCGGCCCCCCCCCCCCCCNCCTTNNCGCNCTCGNCNTNGTTCNTCGCGN
GTTCCNGGNCCNNTCCGCGCNCNCCGTCCGNGNTCCNCTCGCCCCCNCNCCCNNGGNTGG
CNNNCTNANTCGCCNCCATNCNGCTTGTGCNGGTNCCNCACCGGANANGGNGGTGCCGGT
NCCNCNNNCTGNCGCCCGNGGGGCNNGCNCCNNCGCCCGGNTGCCGNCGGCGNCCGNCGA
NGNTNCGNNTCCGCGGNCGCCCTCCNCNNNGNCCNTGNCCCCNCCTNCTCANNCNCCCAG
CTNTGGTTNNGTTTANCCACGCNTCCNCNNAGNTGTTGNCCCTNANTTCCGCGCGCCGCN
CGCCGNGNNCNNGCCAGATTCNGNGANATGNTCACCGCTTCNNCNGGGGGTCTCCNCCCC
GCTCACCCCCNTTNANNGNGcatcncanntcgggtcagcggggtttgtganttttngtaa
tacaancnnctccctacntncttcngtttcccnatnctccgcaanacctngatgtcgcgc
ccgcngagnaggnttnagccnntcggccncnngcgtcgccccnttcnancccattanntg
ancgtcncnccggntgnccctcnncntatgaggtcgcgtgngcccgccanctnnatntga
ntgccagcggcangtcgcncgtgnaatnttggantncnttcncnnctgtnncgcntnccc
cngaaaaanagtcgcgtgntttttntgggaagnccngtttnacgganncacacatnancg
cacnggtgnacgnnnanantttttnnaatcgtcgtgnccncaaagnntnttattgtngcc
gcncncngtatatgtgantcgcctacaagcacannagaaaaaaanaaaaaaag

Library Name / Clone Name np / np56243_0309
Flanking Sequence
cttttnctgcgcacttattgcaagnntacgttaagtggatgtctcttgccgacgggacca
ccttatgttatttcatcatgGTCGAAAGCGAAGGCAGAAAATTCCTCGGCGATCCTCTAG
CTAGAGCTTTGNGTACTCGCAAATTATTAAAAATAAAACTTTAAAAATAATTTCGTCTAA
TTAATATTATGAGNTAATTNAAACCCCACNGGCNTNCTTAGGGNTAATNAACAATTANNN
NNNTNGNTTANTTCAANCNCANNNCNNACCTAAAANTCNNNTCCNTTTNNNTNCCCNTNN
TNGNAGNNNACCGTAANGGGANTNTNTTTGNCCGTCGGGCCCNCNTTAGGTNNTTTAATC
ATGNCCNAAGGCGAGGGCANAAAATCCCTGGGCNANCCTNNGCTTANGCCTTGGGGGNCT
NGCGCNTNNTTAAAATAAAACTTNAGAANTTATTTCCNCCTANTTTATATAAGGAGTAAT
TTAAAACCNACGGCCCTGCTNAGGGTTATTAGACAATTATATCGCTNGGTCCTTCAAACN
CCATANNCATNTTAAAGGTTATTNCCTATATTNNCCCTTNNTTGAATGCAACCNNAAGNG
GATTTTNNNTTGCCCTCNGTNCCACCCTCNCTTATTNNNTCATNCCNAAAGGCNAAGGCC
AANNNNNTCNTTNNNNCATCCTTTNNTTANNGCNTTGNNGNCCTANNGCNNNNGNNAAAN
TANANCTNNNNNANNNTNNNCCTNNNNNTTNNTNNANNAANNNATTTNAAACCNNNNNCC
CTNNNNANNGNTTNNNNNNAntttnanccnnnnnnntttnnancnnnnnnccnnncnaag
nntnntnctnatttnnnnccnnnnnnnnnnaacngnnnnnnannnnnnnnnnnnnnnnnc
cnnnnncntnnnnnnnnnnnnnnnnnnnnnnnnnannnnccnnnnnnnncnannnnn

CLOSE