Detailed Information [112462]

Strain Information
DGRC Number 112462
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}sd[NP1035] / FM7c
Genotype y* w* P{w+mW.hs=GawB}sdNP1035 / FM7c
Break points/Insertion Site 13F1; -; 13F3
Map Viewer
Related Genes CG8509 sd Chc
Original Number 1035
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP1035

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 374
General Information NP_lines
Embryonic Expression a small # of cells (SG)
Larval GFP gut
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Zhang X, Liu H, Lei Z, Wu Z, Guo A.
Lobula-specific visual projection neurons are involved in perception of motion-defined second-order motion in Drosophila.
J Exp Biol. (2013) 216(Pt 3) 524-34 [PubMed ID = 23077158] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np17195_0807
Strand Plus
Insertion Point 15545140
Chromosome Band X
Flanking Sequence
ttttttgtnacttcggtaagcttcggcttcgacgggaccaccttatgttatttcatcatg
GGGCGGGCATACTCGTGAATAGCGAAACCTAAAGGAAATCTACGAAAAAAAAGCTGGCTG
CATGAAAAACATCACCAGCTCGAGCACTTGCAGCACTGGGCTGCTGCAATTGCAGAACAA
CCTGAGCTGCAGCGAGTTGGAAGTTGCCGAGAAGACAGAACAACAGGCAGGTCCGTTGCC
CATCCGAATTACCCAGTCATACAAAGACACACCTCGTAAATCCAAACTCTATGCCATAAA
CCTACAACTCCACCCCCACCCCACACACCCACTCCACATCCAGCGCCCAAAAGTTTGTCg
atcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttt
tcaggaagggcaagccatccgacatgtcatcctntttagaccaatcaaatccatgaagag
catccctgggcataaaatccaacggaattgnggagttatcatgatgagctgccgagtcaa
tcgatacagncaactgnctttgacctttggtactactctcttccgatgatgatgtcgcac
ttattctatgctgnctcaatggtagaggcatatcagtctcnctggntnnnnnntnnnggg
ggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnn


CLOSE