Detailed Information [112465]

Strain Information
DGRC Number 112465
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}CG32795[NP1040] / FM7c
Genotype y* w* P{w+mW.hs=GawB}CG32795NP1040 / FM7c
Break points/Insertion Site 3C1
Map Viewer
Related Genes EG:BACR43E12.1 w EG:BACN33B1.2
Original Number 1040
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP1040

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 89
General Information NP_lines
Embryonic Expression cns + pns large subset (SG)
Larval GFP ubiquitous
Larval X-gal gut, oenocyte
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np19605_0807
Strand Minus
Insertion Point 2546611
Chromosome Band X
Flanking Sequence
atnttttggtgcactgaatttatntgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgGGCCGAAGTATTTAAAACAAAAGTGCAGCGGAAATAGTT
AATAACAAAATATTAGTCGACGGTAGCGGTCCGGTTGTTTTCGTGCTCATCGCGAGTACG
TATTTATTTTTAAAAAATAATAAACGCGGCAAACACAATCACACAAATGTGCAGGCNCAG
TGGGACAAAGTGCGCTAAATTTGGATATGTAATAAATCCAAAACCAAAAAGAAAACAAAA
AACGGNAAAATATTTTACTGNTGTTAAAATTCGATCGTTGANTACATNTTAGANAACCNT
NNTCANNTAACCCATTANTGTTGGGGNNCTGTTTNNGGAANGGCTAGCCATTCGCCCTTT
ATNCTCTTTGGACNCNATCNNAGTGATGNNGNGCATACCTGGGCATAAAANTCAACGGCA
TNGTGGNGCTCTAATGAAGAGCCGCCGNGTCATTCCACCTTTCCACGGCCNTTGACCTNT
GATACTACCCCTCTTTCCGATGATGATGACNCACTTNATTCTATGCTGCCTCAATGTTAG
AGGCATATCAGTCTCCACTGAGNGNNNNNNNNNNNNCCCNNNNNTNNGNGGGNNNNCNNN
TTCCNNGNANGGNCANNCANTNNNNNNNNNNGNCCTTTTNANNCCCAGNAAATNNNGGGN
AAANCNTTNNCNNGGGNNNNNAAAATNNAACNGNANNNGGGGANNNNTTTTTGNANNNNN
NNNNCCAANTNNTTTNNNANannanaannggnnnntnancnttnnggccnnccnnantnt
ncgagggnnatnnngcccttatgntctnnnnnnnnnnnngggngnnnggggnnntnnnnn
nnncnntgagccnnnn


CLOSE