Detailed Information [112502]
 

Strain Information
DGRC Number 112502
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP1095 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP1095 / FM7c
Break points/Insertion Site 20A4
Map Viewer
Related Genes mariner2{}225 micropia{}226
Original Number 1095
Chromosome 1
Comments NP line. Received from the National Institute of Genetics.
Original Comments comment1:C, comment2:19A
Balancer FM7c
Cluster id 501
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression cns subset, a small # of cells
Larval GFP sg
Larval X-gal basitarsus, AIII rings
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np19215_0807
Strand Minus
Insertion Point 21265848
Chromosome Band X
Flanking Sequence
ttttttngtgcactgactttttgtatacttcggtaagcttcggctatcgacgggaccacc
ttatgttatttcatcatgGTCTGCCTCGTCTTTGCTGCGTTTTAGACAGCAAAAAAATTA
CGCGCATCCAAAAAGCAGAGTGAGAGAATGAAGGACCAAAAACCAAATAGAAAACATTAA
ACAAAAACAAGAATGGAAAACCAAAACGAAACGCGGCAAAAGCTTATTGAGCGTTAAATT
AAAAAATTCTTATGAAAAAACAAAACAAAGGCGGAGAAAAAACAGCCAAACACAGACTGA
TTTGGATAAAAACGTAAAAATGGTAAGAACACGGACACGCATAACAAGAAAAACGGTTTA
AAGGCGACGGATATGACGACAATTACTCTGGAATTTCGCATCTGGAATTTCAGCAATTGG
AAAATACATATGTAGTTCGAAATGTATTGCGAAGTAATCTCTTAGTTAGCAAGTGCCCAC
AAGTGTCACACACAAGTCTAGGCCAGTGCCAGATAGATTCGAGAATTCTTAGAGAGGACC
CGTCGNCCAAGAACCCATTATTGGTGGGGTCCCGTTTTTANGGAAGGGCAGNCATTCGAC
ATGTATTCTNTTCAGACCCAATCAATNCATGAAGAGCTTCCCTGGCCTTAAATCCACGGA
NTGNGGGGTTTTATGATGAGCTGGCCGAGTCATCGATNAGTCACTGTCTTGCCCTTGTAC
TACTCTCTTCGATGATGATGTCGCACTTATTCTATGCTGNCTCAATGGTAGAGGCATATC
AGTCTCCTGCCNNNNNNNNNtnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnn
nnnnnttnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np58643_0309
Strand Plus
Insertion Point 21265841
Chromosome Band X
Flanking Sequence
ttttnctgcgcacttattgcaagtcatacgttaagtggatgtctcttgccgacgggacca
ccttatgttatttcatcatgAGGCAGACCTACTATATGTATGTATGTATCCATGTAGTTG
GCTTTAGGAGAGAGCAACTACATTTAGTTGAGTGTGGCGCACACTGAGAGAAAGAACAGA
GTTATTACAATTTCACCATATGGCTGCTATTGGTTAGTTCTGCTTCTGCGATTAGAAAAA
TCGAAAAATCAGACTTTGTCTCTATTGCAAGTAGTAAATGCTATTCGATTCGTCCTCTTT
GATCCTCTAGCTAGGGCCTTTGGCCACTAGTGGATCTGGATCCTCTAGCTAGGNCTTTGA
NCNCCNNNANNCAAANNATGAACNTATNCNCANCTGNNNGNGCNAGGNTAAGNGTNNGNG
NNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

d2 (->Large)

CLOSE