Detailed Information [112513]

Strain Information
DGRC Number 112513
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP1112 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP1112 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 34D1
Map Viewer
Related Genes p38b BG:DS00797.2
Original Number 1112
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1112

NP line. Received from the National Institute of Genetics.

Original Comments comment1:A, comment2:34B6-D1
Balancer CyUW14
Cluster id 1180
General Information NP_lines
Lethality lethal
Embryonic Expression epi stripe (SG)
Larval GFP sg
Larval X-gal rings, basitarsus, AIII, outer pouch,
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np03065_0711
Strand Minus
Insertion Point 13762344
Chromosome Band 2L
Flanking Sequence
tcaacgtgcactgcatttaagtgtatacttcggtaagcttcggctatcgacgggcacnac
cttatgttatttcatcatgGAAGGCGGTCAGTTGGCGCAAGCTGGTTTAGTTTCAATCGG
TCGCTCGTTGGCAGAACATCGAAGGTCCGGGTCGTGACGCTTTTCGCCCGAACGTTTTTT
GCACGAGTTTTTTCCATACGTATTTGTTCATTGACAAAAACTCAAGCTGCGCTCTGTGCG
TGCGTGTGTATGTGTGTGTGCGAGTGAGTGTGTGTGTGCTGGCGCGTCTGTGTGAGTGCG
GTGCTTTGTGTGCAGAATAATTTTTGCAAACATTATGTAAATGCGCAAATTAAAGTTCAA
TCGACGCCCGTTTTGAGTACGAAACCAgatcgaagaatacataagagagaaccgtcgcca
aagaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcattc
cctcttcagaccaatcaaatccttgaagagcatcccctgggcataaaatccaacggaatt
gtggagttatcatgangagctgccgantcaatcgatacaggtcaactgtctttgaccctt
tgttactactctcttccggatgatgatgtcncacttattctatgctgnctcaatgttaga
ggcatatagtctcatncnnnnnntntnttnnnnnnngnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

d2 (->Large)

d3 (->Large)


CLOSE