Detailed Information [112514]

Strain Information
DGRC Number 112514
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP1114 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP1114 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 30C9
Map Viewer
Related Genes CG18854 CG4026 CG4110
Original Number 1114
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1114

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1137
General Information NP_lines
Lethality semi lethal
Embryonic Expression sg, psp, weak (SG)
Larval GFP fb
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np03075_0711
Strand Plus
Insertion Point 9774508
Chromosome Band 2L
Flanking Sequence
anntttaacgtgcactgcntttaagtgtatacttcggtaagcttcggctatcgacgggac
caccttatgttatttcatcatgCTGGCACTCCAATTCCCAGAGAACACTTCGTGAAACTG
CCGAGAGCCGAACGAGCGGCGACGATTGCCGAGCTGTTTgatcgaagaatacataagaga
gaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatcc
gacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatcc
aacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctt
tgacctttgttactactctcttccgatgatgatgtcgcacttattctatgctgtctcaat
gttagaggcatatcagtctccactaagnatntntnttttnnngggggnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnannnnnnnnnnnnnnnnnnn
nnnnnnannnnnnntnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE