Detailed Information [112536]

Strain Information
DGRC Number 112536
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}spin[NP1148] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}spinNP1148 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 52E7; -; 52E5
Map Viewer
Related Genes CG30095 spin CG8430
Original Number 1148
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1148

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 798
General Information NP_lines
Embryonic Expression cns subset
Larval X-gal sg, gc, fg
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np03305_0711
Strand Plus
Insertion Point 11193867
Chromosome Band 2R
Flanking Sequence
gncaacgtgcactganttaagtgtatacttcggtaagcttcggctatcgacgggaccacc
ttatgttatttcatcatgGGCTGATTCACTGCAACTTGGCTGCTTCGTGCCACGTTTCGC
TTCGGTTCGCGGGGGTTCGTGGAGCTTCGGCTCTCTCTCTCTCTNGAGGTCTCTTTGCGG
CTCTCTTTTTCGTTCGCTCGCTCTCCCTTCTTTGGGGCACAACTTGTTGAGCTTTCTGTG
TGTCATTGGTTGTTGCTGTTGCATTTGCCGGCTTCTGATCGAAAAAAACATAAGAGAGAA
CCGTCGCCAAAGAACCCAATTATTGTTGGGGTCCGGTTTTAGGAAGGGCAAAGCNATCCC
GACATGGTCATCCCTCTTCAGACCAATCAAATCCCATGAAGGAGCATCCCTGGGCATAAA
ATCCAACGGAATTGGTGGGAGGTTATAATGAAGAGGCTGCCCGAGTCAATCGATACAGNC
AACCTGNCTTTTGACCCTTTGGTTACTACCTCTCTTCCGATGATGGATGGCCGCACCTTA
NTTCTATGCTGNCTTCAATGTTAGAGGCATATCAGTCTCCACTGANNTCNNATNTTTNGG
NGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnannnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE