Detailed Information [112560]
 

Strain Information
DGRC Number 112560
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP1189 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP1189 / CyO, P{w-=UAS-lacZ.UW14}UW14
Original Number 1189
Chromosome 2
Comments NP line. Received from the National Institute of Genetics.
Balancer CyUW14
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality semi lethal
Embryonic Expression muscle
Larval GFP epi, tr
Larval X-gal epi
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Matsuo E, Seki H, Asai T, Morimoto T, Miyakawa H, Ito K, Kamikouchi A.
Organization of projection neurons and local neurons of the primary auditory center in the fruit fly Drosophila melanogaster.
J. Comp. Neurol. (2016) 524(6) 1099-164 [PubMed ID = 26762251] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np20055_0807
Flanking Sequence
ttttgcgtgcactgnatttaantgtatacttcggtaagcttcggctatcgacgggaccac
cttatgttatttcatcatgCTCGTACTCTTACACGTGTGGATGGTGGTGgatcgaagaat
acataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaaggg
caagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctggg
cataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagt
caactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatg
ctgtctcaatgttagaggcatatcagtctccactgagcatnttntttttnggnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np58933_0309
Flanking Sequence
ttttactgcgcacttattgcaagnntacgttaagtggatgtctcttgccgacgggaccac
cttatgttatttcatcatgAGTACGAGAGAGAGTGAAAGATCCTCTAGCTAGAGCTTTGC
GTACTCGCAAATTATTAAAAATAAAACTTTAAAAATAATTTCGTCTAATTAATATTATGA
GTTAATTCAAACCCCACGGACATGCTAAGGGTTAATCAACAATCATATCGCTGTCTCACT
CAAACCCNANNNGCNTNNTAAGGGNCNATCNCCTNNNCTNTCNCTNATTGNNNGCANACC
NNAAGNGGATGTCTCTTGCTCGACGGGACCACCTTATGTTATTTCATCNTGAGNACGAGA
GAGAGTGAAAGATCCTCTAGCTNGAGCTTTGNGNNCTCNCNAANTNTTCAAAANAAANCT
TTAGAANTANTTNCNNNTAGNNTNANNTTANNCAGNTAATNCANACCCCNCGGNCNNTNC
NANNGGNTNNNNANCANTNNNATNNNNNNNNNNNTNAAACCCNNNNNNCNTNNNNNNGNN
NNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE