Detailed Information [112604]

Strain Information
DGRC Number 112604
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP1284 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP1284 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 22A1; -; 22A2
Map Viewer
Related Genes lea snRNA:U3:22A
Original Number 1284
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1284

NP line. Received from the National Institute of Genetics.

Original Comments comment1:A, comment2:22A1-A2
Balancer CyUW14
Cluster id 990
General Information NP_lines
Lethality semi lethal
Embryonic Expression epi uni (SG)
Larval GFP no larva
Larval X-gal sg, wg-like in wg, Dll-like in leg, cns
Adult GFP no adult
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np17675_0807
Strand Minus
Insertion Point 1422195
Chromosome Band 2L
Flanking Sequence
attttttgggtgcantgccttttttgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgACTCGGATACACAGACACGAAGCAGTAGCCGAAGTGGAC
TTCGGGTGGCGGCTCCGAGGCGAAACGAGAATTCGTTCCTCAGTCGCATTTCGATTGTCA
GCCGGTTCGCATGTGCTGCGGATGCAGATACNGTCCATATATCCGTATCCGTTCGATTCG
TCGGGTTACGCGCGTCGTCGTTCCGGGAAACGGACTTAGTGGCGCCGCCATGGATTCAGA
TGCTAGCGAATAACTAACTCGGAGGAACAGAAATACTGTGTGTGCCAAAACAGAAgatcg
aagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcag
gaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatc
cctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcga
tacagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttat
tctatgctgtctcaatgttagaggcatatcagtctccactngntnnnnnnnnnnnggggg
gnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE