Detailed Information [112614]
 

Strain Information
DGRC Number 112614
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}CG3967[NP1296] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}CG3967NP1296 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 67B4
Map Viewer
Related Genes aay CG3967
Original Number 1296
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP1296

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1840
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression pns (ch) (SG)
Larval GFP gut, fb
Larval X-gal fb, gut
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np20725_0807
Strand Minus
Insertion Point 9380417
Chromosome Band 3L
Flanking Sequence
ttgcgtgcactgaatttaantgtatacttcggtaagcttcggctatcgacgggaccacct
tatgttatttcatcatgCTCCAAACCGTTTTCGTTTTTCGGTCAGTTCAAGAAGACTTCC
AGAATACCCTAACTTCTATGGCTTATATTTTTATCCGCGAATTACGCTCAATTTTCATTT
AATCAGTTTCAATTGAGAGAGAATTGCTTTGGGGGAACGTGAACCTTTgatcgaagaata
cataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggc
aagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggc
ataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtc
aactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgc
tgtctcaatgttagaggcatatcagtctccactgagcatttttttttttgggnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE