Detailed Information [112616]

Strain Information
DGRC Number 112616
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP1299 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP1299 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 78A1
Map Viewer
Related Genes fng CG10586
Original Number 1299
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP1299

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 2011
General Information NP_lines
Embryonic Expression muscle subset, dorsal vessel, anal plate (SG)
Larval GFP tr pit
Larval X-gal sg
Adult GFP ubiquitous in pupal epi
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np17715_0807
Strand Minus
Insertion Point 20867009
Chromosome Band 3L
Flanking Sequence
gnntnttngggnnttttngtttttttttggggantcacaggccngtaanngngaanttaa
ctnggnggcttncggaaaaaccccggctattcgacgggnaccaccttttgttatttcatc
atgCTGTGGCACAAGCTAAAGAGAGAGGATGAGAGCGAGCGCgatcgaagaatacataag
agagaaccgtcgccaaagaacccattattgntggggtccgttttcaggaagggcaagcca
tncgacatgtcattntttttcagaccaatcaaatccatggaagngnggggctgggcataa
aaatccaacggaattggggagntatcatgatgagctggcgngtcaatcganncagncaac
tggctttganccttnggnaccaccncncttcccgnnggangagggngnnccttaatncna
aggcgggccnaaaggggnaaggggctttaaannnnnccccnggaanccattttttttngg
gnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnn


CLOSE