Detailed Information [112730]

Strain Information
DGRC Number 112730
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}alphagamma-element:CR32865[NP1610] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}αγ-element:CR32865NP1610 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 87B12; 87B13
Map Viewer
Related Genes Hsp70Ba CR32865 DM88{}1295 invader1{}1313 DM88{}1314
Original Number 1610
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP1610

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1459 1461
General Information NP_lines
Embryonic Expression sg
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np19895_0807
Strand Minus
Insertion Point 8293637
Chromosome Band 3R
Flanking Sequence
gttntttttnnnnnnatttttttggggtgacactgcccnttttttgtatacttcggtaag
ccttcggctatcgacgggcaccaccttatgttatttcatcatgCAGTAAACGACATACTG
CTCTCGTTGGTTCGAGAGAGCGCGCCTCGAATGTTCGCGAAAAGAGCGCAGCAGTATAAA
TAGAGGCGCTTCGTCTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGC
TTAAGCGAAAGCTAAGCAAATAACCAGGCNNNAGTTGACCAGCTTAACCATTTTGNANNN
AANGGGCAGGTAAAGGNGAATNATTTAAAAGTACCCAGCANCCAANTAAATNAACTGCAN
CTACTGAAATNTGCCAGANGTANTTNTTGAATNCANGANGAGANCTNTGATNCTNTNACA
NGTNNCCGNNAAGANNANCTNCACACANTGCCTGNTTNGNANTNNNNNNNNANNNTNNNN
NNNANCCNNNNNNNNNNACCNNNNTNGNNGGGGNNCNNNNNNNGANGGNNNNNNTNNNNN
NGNNNNNNTNTNNNNNCNNNNNNNNNNNNNNNNNNNNNNNGNNNTNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNCNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNN
NNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np58873_0309
Strand Plus
Insertion Point 8303327
Chromosome Band 3R
Flanking Sequence
cgcaccttattgnagctacgttaagtggatgtctcttgccgacgggaccaccttatgtta
tttcatcatgGTTTACTGTGTGACAGAGTAAGAGAGCATTAGTGCAGAGAGGGAGAGACC
CNCNNCCGGCCGCATAGGCCNCTAGTGNNTCNGGATNCTNTAGNTNGNGCTTTNTTCTGC
CAAACAAATGACCTACCACAATAACCAGTTTGTTTTGGGATTCTAGAANATTCGCTTTAT
TTNGGAAATTTCTTTATAAATACGGCTGCTTAAATAACTTATGTTAAAGATAATCNAAGC
GCTTTGTTATGCGGTTGNTGTCCGTCAGAAAGGCCTATGTAACATTGACAATATACTCTT
TAAAATGTATGTATATATTAACTTAAAAAAGCCANATTTTTATTAGATTTATACAGACAA
TTGCATGATGATTGCTTGCCTTTTTTAATTTAAAANNATNTATTTTATGAATATGATNTA
TGTTTGNACATATATATTATGNATTACATANGCATGCAAAACATATGCAAAAAGCCGNGG
CTTTTNTNAAAGNTNTNNAATGTNAACNAAACNTNATAACTCATTTTTTCCATGGCTNTT
GNNTTTGGACTTTCTNTTTACTTTTCTNANCCGCNCNTTTCCCNTNNTAACCTTNCGNCC
TTANGNNTTTACTGGNATTGATCCTNTNNCTTTGNGNTTTTGTNTCCCNNTNNCNCCCNC
CTNTTTCCCTTTNTNCGCCNTCTTTTTNCCCTTTNTTTTTTTCNTTTTNCTTCCNNCCCN
CCCCCCNTTTTTCCCCCTTTtncccnntttttttttccctnancccnncccntnnngncn
cctntttatncccnctcccanccntttttnnncccatnttttttnncctccttnnccntt
ccnnncttcccctcccctnctccctntntnttcncngctntcntttccncannntttttt
t


CLOSE