Detailed Information [112737]
 

Strain Information
DGRC Number 112737
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}Pi3K59F[NP1626] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}Pi3K59FNP1626 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 59E4
Map Viewer
Related Genes CG30184 alphaPS5 Pi3K59F
Original Number 1626
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1626

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 928
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression sg
Larval X-gal sg
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Juhasz G, Hill JH, Yan Y, Sass M, Baehrecke EH, Backer JM, Neufeld TP.
The class III PI(3)K Vps34 promotes autophagy and endocytosis but not TOR signaling in Drosophila.
J. Cell Biol. (2008) 181(4) 655-66 [PubMed ID = 18474623] [RRC reference]

Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np26445_0807
Strand Minus
Insertion Point 18604080
Chromosome Band 2R
Flanking Sequence
ctgncttnnttgtatacttcggtaagcttcggctatcgacgggaccaccttatgttattt
catcatgAGCTGTCCACAACAGAAAACAGCTGTNCGGACGGCGACACGGCGAAGTACAGT
GGGCGCTGGCTAAGACGTAAGCTGAACAAAGAAATCGCCACGTTAGCTTTTATTAGGCAA
ACCATTCCATCTTATTCATACAAAACCATNCTAGTATTCATATTATTATTTNGATTTATT
TGATAATAATNTTATAATAATTTGTATACTATTTGATAAATATTTCCTTTAATTCGTNTC
TTATGCTATAAAATATTTAATTATTTTTATTAAAGGGATTATNCATTAAGATTATCTACA
AGGTCCTTNATCATTAACAACTTATTAATTTTGTAAATCAGAATGCATTTGCACGTTGAT
TTCCTCTTGGGTGCCTTCACAATGCGGTGCAGGTTTCTTTNGTGCTCGGNTCGAAGAATG
CATNAGGAGAGNACCGGTCGCCAAAGAACCCATTATTGTTTGGGGGTNCCGTTTTCAGGG
AAGGGGCAAGGCCACCTCNNCATGNNGATTCCTCTTTAGACCAATTCAAAANCCCNGGGA
GAAGCATTCCCCTGGNCCTTAAAANCCCANNGNNATTGGGNGNAGCGAATNCANGGAACG
AGNCNGNGCGTNNTGNAANCNGTTTCNGGAGNAACTGGGCTTTNGACCCTNTGNGACCNA
CNTNTTGTTGGCGGANGNATCAANGTGGCAGCCTTCGTTAGTGATGGCNGTGGTCNAAAG
GNGGGNGGCCNNTCGNAGAGggncccctgggnancccangnngtcnccncgtgntcgcan
ncccttggngnnttttttnatncnntcncttcttngtgnccccntncncgttcgtncntn
ngacttnctntnntttcncnnttcgttcngnttcnntncnctccntctnccnccntnctt
nacntgnnangccntttcccnacntgncnnnntncannngnnnnctcnangcnngatngn
ctcgcntnacnncg

Library Name / Clone Name np / np61113_0309
Strand Plus
Insertion Point 18604074
Chromosome Band 2R
Flanking Sequence
gagggcccgnnnngnnnngtntttggnnnggtnttngnggnaaaaaccncagtttacgtt
aagtggatgtctcttgccgacgggaccaccttatgttatttcatcatgGGACAGCTGTTG
TGGCTGCTCCGCGAAAATTGCGCAGAAAATAAAAAAGTGAATTGGCAGCAGGAAAATGGA
CCAGCCCGACGACCATTTCCGCTACATACACAGCTCCTCGCTCCACGAGCGAGTGCAAAT
CAAGGTGTAAGTGAAGAAGGCCACGGAGAGGCCACGTGGGGAGGAACTGGCGAACCCAAT
CATTATTGTTGCTTTTCACAGAGGGACGCTCGAGGGGAAGAAGCGCCAGCCGGACTATGA
GAAACTGCTAGAGGATCCGATCCTGAGATTNTNGGGCCTGTACTCCGAGGAGCACCCCTC
GTTCCAGGTGCGCCTGCAGGTTTTCAACCAGGGCAGACCCTACTGCCTCCCAGTGACCAG
CTCCTACAAGGCGTTCGGCAAGCGATGGAGCTGGAACGAGTGGGTGACGCTGCCGCTGCA
ATTCTCCGACCTGCCCAGAAGCGCCATGCTGGTGCTGACCATCCTGGACTGCTCGGGCGC
GGGCCAGACCACGGTCATTGGAGGCACCTCCATCTNAATGTTCGGCAAGGACGGCATGTT
CCGCCAGGGAATGTACGACTTGCGAGTGTGGCTGGGAGTCGAGGGCGATGGCAACTTTTC
CAGTCGCACGCCCGGCAAGGGCAAGGAGTCGTCCAAGTCGCANATGCAGCGCCTAGGAAA
GCTGGCCAAGAAACACANGAacggccaggtgccaaaaggnggactggctggacagactga
cgtttcncgaatnnaggngatcctnactgnnnnnttttnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nc

CLOSE