Detailed Information [112741]

Strain Information
DGRC Number 112741
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}CG6340[NP2007] / FM7c
Genotype w* P{w+mW.hs=GawB}CG6340NP2007 / FM7c
Break points/Insertion Site 13C5
Map Viewer
Related Genes CG6324 CG6340
Original Number 2007
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP2007

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 360
General Information NP_lines
Embryonic Expression gut, sg, mt
Larval GFP sg
Larval X-gal sg, epi
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np26565_0807
Strand Plus
Insertion Point 15214325
Chromosome Band X
Flanking Sequence
gnccttnantgttacttcggtagcttcggctatcgacgggaccccttatgttatttcatc
atgGTCCGCGCGGCAAGGAACGAGAAAGAGAGCGCGAGCGGGAGAGAGAGAAGACAAAGC
CGATGTCGCAGCAGCAGAGTCATAGGAGCAGCAGCAGAGGACGCATTGATGAGGTAAAGA
CTTGCCGTTGCACCAAATCGATATTTACTTCCCATAATATATACCAAATACCATATGCTA
TTGTACTCCATACGTATGTGTGTGTGTGTGTATCTGGGTTGGAGCGCAAGCGgatcgaan
aatacataagagagaaccgtcgccaaagaacccattattgntggggtccgttttcaggaa
gggcaagccatnccacatgttatncttttcagaccaatcaaatccatgaagagcntccct
gggcataaaatccaacggaattggggagttatnatgatgagctgccgagtcaatcgatac
aggcaactggctttgacccttggtactactcttttncgaggagatggcgcactttttttt
tgctgncttaatggtagangcatattagtctccactgagcattttttttttngggggnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE