Detailed Information [112743]

Strain Information
DGRC Number 112743
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP2009 / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}NP2009 / TM3, Sb1 Ser1
Break points/Insertion Site 87B13; 87B14
Map Viewer
Related Genes Hsp70Bb Hsp70Bbb Hsp70Bc CR32865 invader1{}1313 DM88{}1314
Original Number 2009
Chromosome 3
Comments NP line. Received from the National Institute of Genetics.
Balancer TM3 Sb Ser
Cluster id 1461 1464
General Information NP_lines
Embryonic Expression pns subset
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np26585_0807
Strand Minus
Insertion Point 8331463
Chromosome Band 3R
Flanking Sequence
tttttggggcctgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccacc
ttatgttatttcatcatgTCTCGAACCAACGAGAGCAGTATGCCGTTTACTGTGTGACAG
AGTGAGAgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggg
gtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatcc
atgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgc
cgagtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatgatga
tgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgagcatct
tntttttngggnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnntnnnnnnnnnnntnnnn
tnnnntnannnnannannnnnnnnnnnnnnnnannnnnnnnnnnnnnnnnnncnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnttnnntnna
nnnnnnnnnnnnnnnnnnnnnaannnnnnnnnnnnnnnttnnnnnnnnnngnnnnnnnnn
nnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnannnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np61153_0309
Strand Minus
Insertion Point 8303307
Chromosome Band 3R
Flanking Sequence
attttnntgcgcacttattgcaagtnntacgttaagtggatgtctcttgccgacgggnac
caccttatgttatttcatcatgGTTCGAGAGAGCGCGCCTCGAATGTTCGCGAAAAGAGC
GCAGCAGTATAAATAGAGGCGCTTCGTCTACGGAGCGACAATTCAATTCAAACAAGCAAA
GTGAACACGTCGCTAAGCGAAAGCTAAGCAAATAAACAAGCGCAGAAGGAGTGTTGAAAA
TATGTATGTAATATGTATGTATATGTCGCAGATCCTCTAGCTAGAGGCTTNGNNNACTCG
NNNATTATTAAANCTANAACTTNAGANANTNATTTCTTCTAATTAATATGATCAGANATA
ACCNCCCCACNNCCTNCCTAANGNGGTATTGATCNACTGATATGATGCGGTGGGTNACTT
CAATGCTCTGTACNANAGCNAGAAGTANTCTNACTNATGCTGNCTNTNTNNGNATGNNTG
CNTGCGGNCTATANCANCTTGNNNTAATNGACCNGNTNTTGTTTGTTAAGNNNNGAACTA
CNCANCNNCTNNTTGTTGTNNNAAAANTGCTCTNNTAANNNNNGGNNNNNNNNNNCNCNN
NGCNNNNNNNNNNNNCAACCNNNNNNNNCACNCNNTNTNNNNNNCTNNNNNNNANCNNNN
NCNNNNGNGNGNGNNNANTNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE