Detailed Information [112748]

Strain Information
DGRC Number 112748
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}CG18549[NP2022] / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}CG18549NP2022 / TM3, Sb1 Ser1
Break points/Insertion Site 87B11
Map Viewer
Related Genes CG18549 CG5509 CG5538
Original Number 2022
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP2022

NP line. Received from the National Institute of Genetics.

Balancer TM3 Sb Ser
Cluster id 1458
General Information NP_lines
Embryonic Expression a small# o cells
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np26635_0807
Strand Minus
Insertion Point 8275450
Chromosome Band 3R
Flanking Sequence
tnanttttcttcggtagcttcggctatcgacgggaccaccttatgttatttnatcatgGT
CTGGAATGCCGTAAAGACGAACATAAAGCCAAAGCCCAGGATGAGTATCATTAAGAATTT
GAAATCCATCCTGCTGCTGCGCTATGTCTTTTCCAATCACAATAGAACCGAATTAAATTA
ACTTGCCGCGCACTTTTGCATTTGCGTTTGCAGTTGCCGACGTAACCAGAGAGGGGGAga
tcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgtttt
caggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagc
atccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaat
cgatacagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcact
tattctatgctgtctcaatgttagaggcatatcagtctccactgaagccatncttttntt
ggggnnnnnnnnnnngnnnnnnntttnnnnnnanntcntagtnannaaagagnagnnaga
ngaggggnnagtagangngagnanagagnnanannagataantntntntcnnnangctnn
nncncnacgcttttttttttncnntntnnnnnntnnnnctnctnttnntctccnctcncc
ntnnctntnnnnntnnacnannnantnnncatntnatnnnnnntnnnnctntnnntctnn
nnnnnnnnnnnnnnnntttntcnnnnnnccnngnnnnnnntncnnnnntnntnttnntnn
tcnnnnnttcccncnncnnntncntnnnnnncnnanttntnnnttcttnnnncnnnntnn
cngnccccnntnnttnnntntttccnnnggngncntanangnnnnttnttntntcnnnng
nnnnnnntnnann

Image Files
Disc

d1 (->Large)


CLOSE