Detailed Information [112763]
 

Strain Information
DGRC Number 112763
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP2056 / CyO
Genotype w*; P{w+mW.hs=GawB}NP2056 / CyO
Original Number 2056
Chromosome 2
Comments NP line. Received from the National Institute of Genetics.
Balancer CyO
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression scattered cells
Larval GFP tr node
Larval X-gal epi, gut, tr
Adult GFP bristle
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Matsuo E, Seki H, Asai T, Morimoto T, Miyakawa H, Ito K, Kamikouchi A.
Organization of projection neurons and local neurons of the primary auditory center in the fruit fly Drosophila melanogaster.
J. Comp. Neurol. (2016) 524(6) 1099-164 [PubMed ID = 26762251] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np26835_0807
Flanking Sequence
tctttttngtgcactgaatttaantgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgGTTCCAGCATTTCTCGCCCGCACTTCgatcgaagaatac
ataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggca
agccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggca
taaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtca
actgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgct
gtctcaatgttagaggcatatcagtctccactgagccatcttttttttgggnnnnnnnnn
nnnnnnnnnnnnnnannnnnnacnnnnnnacntgnnntntgaccttngnnactactntnt
tnncnnngangangncnnacttnattntatgctgnntnanngnnnnaggcntntnannct
ncactgaanccaatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaaaaaaaaaaaan

Library Name / Clone Name np / np61213_0309
Flanking Sequence
GNNNNNNGNNGNNGGGNGGGGNNNNGNNNNGGGGGGCNGGGNNNGNGNNNNNGTTTTTTT
GGGNNNGGNTNTATTTTGGGGGGGNNAANAAANCCCCCNAGTTTTTTACGTTNANGNTGG
NNGTCCTCCTTGCNCGNACGGGNACCACCTTNATGTTATTNTNCATNCATGGNCTGGNAA
CCGNAAGNCCGCNCGNACGTTTGTTNTTACTAACCGCTACTTCTACACTTAGNAAACATT
TTTGTGGCACTTTGCAAGTTAGNACCAGNATTATTTTGTAGTTTAGTTTAAAATCTTATT
TATTTATTTTGCATTCTCCCAAGTTTTTCATAAAATTATAGTTTTTTTTGTATTTCAATG
TTTTTTTCATTATATTCCCTATCTTTTTTTTGGGTGCACCCCTATATAAAAAGAGNGGAA
ATCTTCAGAGAGACCCGGAAAGTGTGAGCGGGAGGAGGCGGGGGATCCTGNACCNNNAGC
CNTNGACACGTGTAAGAGTACGANAGAGAGTGAAAGATCCTNTAGCTAGAGNCTTNGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

CLOSE