Detailed Information [112767]
 

Strain Information
DGRC Number 112767
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP2067 / CyO
Genotype w*; P{w+mW.hs=GawB}NP2067 / CyO
Original Number 2067
Chromosome 2
Comments NP line. Received from the National Institute of Genetics.
Balancer CyO
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression cns brain
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np26885_0807
Flanking Sequence
GGNANGCTTCGGCTNTCGACGGGACCCCTTATGTNTTTATCATGATATGGACTTTAGACT
TTAGGATTCTGATCGAAGAATACATAAGAGAGAACCGTCGCCAAAGAACCCATTATTGTT
GGGGTCCGTTTTCAGGAAGGGCAAGCCATCCGACATGTCATCCTCTTCAGACCAATCAAA
TCCATGAAGAGCATCCCTGGGCATAAAATCCAACGGAATTGTGGAGTTATCATGATGAGC
TGCCGAGTCAATCGATACAGTCAACTGTCTTTGACCTTTGTTACTACTCTCTTCCGATGA
TGATGTCGCACTTATTCTATGCTGTCTCAATGTTAGAGGCATATCAGTCTCCACTGAAGC
CATCTTTTNTTTGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnn
nnnnnnntnnnnnntnnnnnnnnnnnnnngnnnnnnnnnn

Library Name / Clone Name np / np61223_0309
Flanking Sequence
ntatnntggggggaaaaacccgcaantntangngtaagtggaatgtctcttgccgacggg
caccaccttatgttatttcatcatgGGCCAGANNANAAAAGNNNGAGACCGTAGGNNTGA
AGNCANNNGCAANAAGAACANGGTACCANGNGNNCANTGNGAGACCNAAGCGAAAAAGGT
NTNGGNCTCTTNNNNAATAAAAAGANNGTAACNCAGAAAGGGGACCNACGTTTTTTTTTN
GTCGGACACNNATAANTNTACGCGGAGTATNTNATTATATACANNCATATNNCTCNANNA
CTATANATGATGGTTGAGGGGCNNNGGTAAAGNGTNAGNGNANNAACNNANTNCATCNAC
ATTTTANNNGCATGAGNGTCCCCTNCGTNNCNNCGNNAGATGANCNNNANACTAATCCAA
NCNCCCAANCTGGCGAACGCCNNCANTCGNNNCTCACNTNNACAGGNNNNAAATANCNGN
GNCCNANTNCCCTCAATTNTNNGTTCCAGNGCANNNCCNCCACGCGNCNCNTNNTTNCGN
NCNCNCCNGCCNCAANCACGNTTNCGCNNCNCAGCANAAAAAANANGAATTANNCGCNTN
GAGGTNNCGNAGCGNNNGGCCNNANATAACGCACNTGNCCNGANTNTNNGGNNNNNNNCC
NGAACACNACCACAANCNNCNCCNTNCNCGATTCGACGCNCCGGGGNNANANAAAAGGGG
TGGGNNGGCNCAAATCGTGGTCNCCGCNCNCAGATATNNNCNCCCCNATNNNNTGNGGTN
CTCCCNCNACCANTTNTATCcggtacgcgaccccccgncnccaaacggtncgcnngcang
ngtnnnangaanttcnncccccnnngatnnnnannnngnngnccnntnagtncgngaccc
nnatngnnaaatanccggcgncnagttaccantagnnanatgccggncgaccnncnngcc
naganggncacacnaggngcnngcngcgcgtntnnacggccnancgccgcacccgngag

CLOSE