Detailed Information [112786]

Strain Information
DGRC Number 112786
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}CG9171[NP2111] / CyO
Genotype w*; P{w+mW.hs=GawB}CG9171NP2111 / CyO
Break points/Insertion Site 25F5
Map Viewer
Related Genes CG14005 CG31913 CG9171
Original Number 2111
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP2111

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 1045
General Information NP_lines
Embryonic Expression pns subset (ch?)
Larval GFP ubiquitous
Larval X-gal sg, mt
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np28275_0807
Strand Minus
Insertion Point 5792411
Chromosome Band 2L
Flanking Sequence
gtttttttnnnnnnantaacntgnnngtgacactnccctttnntttgtatacttncggta
agccttcggctatcgacgggnaccaccttatgttatttcatcatgCCACAGACTTTTTGT
AGGCTTTTCCACTTTTTCGATTTCGAGACTTCGAGCGAAACGGTCGTGTTTTTCGCGTGT
GTGCGGGTGGCGGACGCGCGTGCCAATCGGAAAAGGCCTTTAAATCAAATGAGTGGCTCG
CCAAAGGAGCGCATCAAGGTGTGTGCGATTGTATCGAGTGTGTGTGCTTGTGCGGTGCGG
AGAAAGCCAGCCAGCCGCCAGTCTGGGATAAAAATAAAGATTAAGATTGGGATAAAACAA
Agatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgt
tttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaag
agcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtc
aatcgatacagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcgc
acttattctatgctgtctcaatgttagaggcatatcagtctcctnctnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnn

Image Files
Disc

d1 (->Large)


CLOSE